<?xml version="1.0"?>
<?xml-stylesheet type="text/css" href="https://www.botanicalauthentication.org/skins/common/feed.css?303"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.botanicalauthentication.org/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Admin</id>
		<title>AHPA Botanical Identity References Compendium - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.botanicalauthentication.org/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Admin"/>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Special:Contributions/Admin"/>
		<updated>2026-06-15T07:21:24Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.19.20+dfsg-0+deb7u3</generator>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Logo.png</id>
		<title>File:Logo.png</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Logo.png"/>
				<updated>2025-09-19T16:58:08Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Admin uploaded a new version of &amp;amp;quot;File:Logo.png&amp;amp;quot;: Revised to be square&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Logo.png</id>
		<title>File:Logo.png</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Logo.png"/>
				<updated>2025-09-19T16:50:28Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Admin uploaded a new version of &amp;amp;quot;File:Logo.png&amp;amp;quot;: Added ERB Foundation emblem&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Smilax_aristolochiifolia_(root)</id>
		<title>Smilax aristolochiifolia (root)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Smilax_aristolochiifolia_(root)"/>
				<updated>2020-10-15T17:52:44Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* images removed for updating on request via PF from contributer */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Smilax aristolochiifolia'' (root) }} {{askbox|herb=''Smilax aristolochiifolia''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
{{nomenclature | binomial=Smilax aristolochiifolia&lt;br /&gt;
|authority=Mill.&lt;br /&gt;
|family=Smilacaceae&lt;br /&gt;
|scn=sarsaparilla&lt;br /&gt;
|syn=''Smilax medica'' Schltdl. &amp;amp; Cham.; ''Smilax ornata'' Lem.&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=gray sarsaparilla; Mexican sarsaparilla; Vera Cruz sarsaparilla&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2     | cat=Voucher &lt;br /&gt;
&lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Smilax_aristolochiifolia_Tropicos_26042.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/26042&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/26042&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | source2=MOBOT, Tropicos.org&lt;br /&gt;
             | image2=Smilax_aristolochiifolia_Tropicos_27626.jpg&lt;br /&gt;
             | companyimage2=TropicosLogo.gif&lt;br /&gt;
             | companyURL2=http://www.tropicos.org/Image/27626&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/27626&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''S. medica'' has an angular stem, armed with straight prickles at the joints, and a few hooked ones in the intervals. The leaves are smooth, bright green on both sides, shortly acuminate, five-nerved, with the veins prominent beneath. They vary much in form, the lower being cordate auriculate-hastate, the upper cordate-ovate. In the old leaves the petiole and midrib are armed with straight subulate prickles. The inflorescence is an umbel of from eight to twelve flowers, with a smooth axillary peduncle and pedicels about three lines long.&lt;br /&gt;
&lt;br /&gt;
The Mexican or Vera Cruz sarsaparilla is derived from this species. ... [The roots] consist of a head or caudex with numerous long radicles, which, however, are somewhat smaller than in that variety, and have a thinner bark. They are often also much coiled with earth. It contains but little starch and has quadrangular endodermal cells, with thickened walls, and more or less oval lumen.}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1409.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 3053.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Under the microscope, transverse sections of all of the commercial varieties of Sarsaparilla show an epidermal layer with basal portions of root hairs; a hypodermis composed of several layers of strongly lignified cells, the walls being uniformly thickened, except in Mexican Sarsaparilla in which the inner walls are only slightly thickened; a cortex composed of numerous parenchyma cells mostly containing starch, some containing resin or raphides of calcium oxalate; an endodermis of a single layer of strongly lignified cells, the walls being' uniformly thickened except in Mexican Sarsaparilla in which the outer walls are only slightly thickened; a central cylinder composed of radial bundles connected with sclerenchymatous fibers, the tracheas being large and oval and the phloem in small groups at the periphery of the bundle; and a pith composed of starch-bearing parenchyma cells. &lt;br /&gt;
&lt;br /&gt;
Powdered Sarsaparilla is light grayish-brown to dark grayish-brown; when examined under the microscope it exhibits numerous starch grains, from 0.003 to 0.023 mm. in diameter, spherical, or biconvex or spherical-tetrahedral, single to 2- to 4-compound, and frequently with a central-elliptical cleft; calcium oxalate in raphides, from 0.006 to 0.035 mm. in diameter, occurring singly or in groups; cells of the hypodermis and endodermis with lemon-yellow or reddish-yellow porous walls and, in the case of Mexican Sarsaparilla, showing an uneven or irregular thickening, the individual cells from 0.08 to 0.5 mm. in length; fragments of trachea) with simple and bordered pores or scalariform or reticulate thickenings associated with sclerenchymatous fibers having rather thin, very slightly lignified and porous walls. }}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Vaccinium_myrtillus_(fruit)</id>
		<title>Vaccinium myrtillus (fruit)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Vaccinium_myrtillus_(fruit)"/>
				<updated>2018-10-17T17:49:26Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Vaccinium myrtillus'' (fruit)}} {{askbox|herb=''Vaccinium myrtillus''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Vaccinium myrtillus&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ericaceae&lt;br /&gt;
|scn=bilberry&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=European blueberry; huckleberry; whortleberry&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{media2 |cat=Voucher&lt;br /&gt;
|companyimage=Starr herbarium logo.png&lt;br /&gt;
| companyURL=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
| companyimage2=Starr herbarium logo.png&lt;br /&gt;
| companyURL2=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
| mainimage=Vaccinium myrtillus L. var. californicum - Starr - 00010601.jpg&lt;br /&gt;
|caption1=''Vaccinium myrtillus'' L. var. ''californicum''&lt;br /&gt;
|source=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
|image2=Vaccinium myrtillus L. var. microphyllum - Starr - 00010602.jpg&lt;br /&gt;
|caption2=''Vaccinium myrtillus'' L. var. ''microphyllum''&lt;br /&gt;
|source2=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Macroscopy &lt;br /&gt;
| source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 619.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
             | &lt;br /&gt;
| source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile_-_2538.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Microscopy | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | description=Cellular structures identified in this botanical specimen are the group of thick walled stone cells from the inner fruit wall and the large oil droplets when observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
{{Media2 |cat=Microscopy |companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL= http://www.alkemist.com&lt;br /&gt;
 |companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2= http://www.alkemist.com&lt;br /&gt;
|mainimage= Bilberry berry whole.jpg&lt;br /&gt;
           |caption1= Group of thick walled stone cells from the inner fruit wall observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source= Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
|image2= Bilberry berry whole-1.jpg&lt;br /&gt;
           |caption2= Large oil droplets observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source2= Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=HPTLC Association&lt;br /&gt;
             | companyimage=HPTLC-assoc-Logo-farbig-Text-schwarz-300x47.png&lt;br /&gt;
             | companyURL=http://www.hptlc-association.org/&lt;br /&gt;
             | mainimage=Vaccinium myrtillus-hptlc-association.png&lt;br /&gt;
             | caption1=''Vaccinium myrtillus'' (fruit) HPTLC ID -  Developed, white RT&lt;br /&gt;
             | description=Bilberry (fruit) (''Vaccinium myrtillus'')&lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Stationary phase, i.e. Silica gel 60, F254&lt;br /&gt;
             | mobilephase=1-Butanol, formic acid, water 65:16:19 (v/v/v)&lt;br /&gt;
             | prep=Sample: Mix 1 g of powdered sample with 10 mL of methanol and sonicate for 10 minutes, then centrifuge or filter the solutions and use the supernatants / filtrates as test solutions.&lt;br /&gt;
&lt;br /&gt;
Derivatization reagent: no derivatization &lt;br /&gt;
             | detection=Saturated chamber; developing distance 70 mm from lower edge; relative humidity 33%&lt;br /&gt;
             | referencesamples=Reference: Dissolve 2 mg of pelargonin in 5 mL of methanol. Dissolve 2 mg of delphinidin in 5 mL of methanol. Optional: dissolve 2 mg of malvidin in 5 mL of methanol. &lt;br /&gt;
             |&lt;br /&gt;
             | lanes=Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 3 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 4 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 2 µL	Bilberry fruit&lt;br /&gt;
# '''3 µL	Bilberry fruit'''&lt;br /&gt;
# 4 µL	Bilberry fruit&lt;br /&gt;
# 2 µL	Pelargonin&lt;br /&gt;
# 2 µL	Malvidin&lt;br /&gt;
# 2 µL	Delphinidin&lt;br /&gt;
# 2 µL	Mallow flower&lt;br /&gt;
# 4 µL	Mallow flower&lt;br /&gt;
# 6 µL	Mallow flower&lt;br /&gt;
# 2 µL	Roselle flower&lt;br /&gt;
# 4 µL	Roselle flower&lt;br /&gt;
# 6 µL	Roselle flower&lt;br /&gt;
 &lt;br /&gt;
             | notes=''Images presented in this entry are examples and are not intended to be used as basis for setting specifications for quality control purposes.''&lt;br /&gt;
System suitability test: Pelargonin: red to orange zone at Rf ~ 0.89; Delphinidin: violet zone at Rf ~ 0.80&lt;br /&gt;
&lt;br /&gt;
Identification: Compare result with reference images. The fingerprint of the test solution is similar to that of the corresponding botanical reference sample. Additional weak zones may be present. The chromatogram of the test solution shows four violet to violet-blue zones between Rf ~ 0.46 and 0.58.&lt;br /&gt;
&lt;br /&gt;
Test for adulteration: No intense violet zone is seen at Rf ~ 0.35 (Mallow flower). There is neither a blue zone at Rf ~ 0.37 nor a violet zone at Rf ~ 0.44 (Roselle flower).&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC-AHP-NCNPR Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=BAPP-logo-2018-2line-LOW2.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/BilberryLabGuidanceDocument.html&lt;br /&gt;
             | description=Bilberry (fruit extract) (''Vaccinium myrtillus'')&lt;br /&gt;
             | characteristics=This ABC-AHP-NCNPR Botanical Adulterants Prevention Program [http://cms.herbalgram.org/BAP/LGD/BilberryLabGuidanceDocument.html Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic bilberry extracts and non-authentic materials, with particular discussion of known chemical markers of other anthocyanin-rich fruit extracts, synthetic dyes, and a detailed literature review (including HPLC and HPTLC characterization methods).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical  | source=AHPA Known Adulterants&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | description=Bilberry (fruit extract) (''Vaccinium myrtillus'')&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Red dye #2 (amaranth dye)&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Practical: Detecting Artificial Dye Adulteration in &amp;quot;Bilberry&amp;quot; Extracts ==&lt;br /&gt;
[[Category:AHPA Practicals]]&lt;br /&gt;
[[File:AHPA Logo.gif|right|150x75px|link=http://www.ahpa.org/]]&lt;br /&gt;
=== Introduction ===&lt;br /&gt;
The American Herbal Products Association is providing here analytical tools and methods to identify adulteration of powdered raw materials labeled as bilberry (''Vaccinium myrtillus'') extract. There are well-established scientifically valid methods for determining the presence of red dye in materials purported to be powdered bilberry extracts. They are provided now as immediately available practical tools for industry in order to deal appropriately with reports of adulteration of this ingredient and make wise purchasing decisions.&lt;br /&gt;
=== &amp;quot;Bilberry&amp;quot; Extracts Adulterated with Artificial Dyes ===&lt;br /&gt;
In the process of evaluating commercial material labeled as bilberry extract, AHPA member company MediHerb investigated a sample that appeared to meet the listed specification for anthocyanin content by simple spectrometry. However upon further analysis it was discovered that this material was not likely derived from bilberry and was in fact adulterated with amaranth dye (red dye no. 2). Their work has since been published (see: Bilberry adulteration using the food dye amaranth. Penman KG, Halstead CW, Matthias A, De Voss JJ, Stuthe JM, Bone KM, Lehmann RP. [http://pubs.acs.org/cgi-bin/abstract.cgi/jafcau/2006/54/i19/abs/jf061387d.html J Agric Food Chem. 2006 Sep 20;54(19):7378-82]).&lt;br /&gt;
&lt;br /&gt;
Subsequent to the work by Penman et al., Steven Dentali, PhD, AHPA’s vice president of scientific and technical affairs, authored an article published in the trade journal Nutraceuticals World, which can be accessed [http://www.ahpa.org/portals/0/IA/Bilberry/07_0700_BilberryAdulteration_NutraWorld.pdf here]. This article warns that lower price material available from nontraditional sources can be an initial indication of an adulterated extract. This is especially problematic where common methods of analysis are easily “cheated” so that a specification is met, but the material is not what it should be. &lt;br /&gt;
&lt;br /&gt;
The information presented here is intended to educate industry about the potential quality problem with ingredients labeled as bilberry extract and to provide a scientifically valid method to aid in the differentiation between genuine bilberry fruit extract and material adulterated with amaranth dye. When examined with these methods by qualified individuals, information should be obtained that will allow more informed purchasing decisions than may be available with single wavelength spectroscopic analysis.  &lt;br /&gt;
=== Methods for Detection of Dye in &amp;quot;Bilberry&amp;quot; Extracts ===&lt;br /&gt;
==== Anthocyanins turn blue at elevated pH ====&lt;br /&gt;
Bilberry extracts are blue-black in color but form a pink solution when diluted at neutral pH. At elevated pH, anthocyanins change color and anthocyanin-containing solutions, such as can be made by diluting bilberry extract with water, turn blue. This is illustrated [http://www.ahpa.org/portals/0/IA/Bilberry/VM001.pdf here] where the far left solution is very dilute true bilberry extract, next is this solution with the pH adjusted to greater than 10, next is dilute fake bilberry extract under the same conditions, and lastly very dilute fake bilberry extract. &lt;br /&gt;
&lt;br /&gt;
This experiment is simple to replicate with bilberry extract or any other anthocyanin-containing materials and so is not necessarily indicative of bilberry anthocyanins. In fact this principle is easily observable by adding baking soda to dilute anthocyanin containing solutions.  A “kitchen test” using diluted red wine, or grape juice, or other suitable (anthocyanin-containing) juice can be performed to illustrate this property of anthocyanins. Sprinkling baking soda into such a prepared dilute reddish solution will cause it to turn purple or bluish. This same color transformation will happen with bilberry (or other anthocyanin containing) extract, but does not occur with amaranth dye.&lt;br /&gt;
&lt;br /&gt;
==== High performance thin layer chromatography (HPTLC) ====&lt;br /&gt;
Authentic bilberry can be easily differentiated from materials adulterated with amaranth dye under the HPTLC conditions used to create the image shown [http://www.ahpa.org/portals/0/IA/Bilberry/VM002.pdf here]. Lanes 1 and 4 are authentic bilberry extract. The horizontal colored bands represent anthocyanin compounds. The adulterated samples in lanes 2 and 3 have a different pattern of colored bands and, most notably, a bright red band that corresponds to amaranth dye. The last lane shows what pure amaranth dye looks under these same conditions. &lt;br /&gt;
&lt;br /&gt;
Click [http://www.ahpa.org/portals/0/IA/Bilberry/VM003.pdf here] for the HPTLC conditions used to produce this result.&lt;br /&gt;
&lt;br /&gt;
=== Other Relevant Sources of Bilberry Information ===&lt;br /&gt;
==== AHP and USP monographs ====&lt;br /&gt;
The American Herbal Pharmacopoeia and Therapeutic Compendium has published a bilberry fruit monograph that includes standards of analysis, quality control, and therapeutic information. More information can be found at [http://www.herbal-ahp.org/titles.htm].&lt;br /&gt;
&lt;br /&gt;
The United States Pharmacopeia has published a dietary supplement monograph for powdered bilberry extract as an in-process revision in the Pharmacopeial Forum, July–Aug. 2007;33(4):685-688.&lt;br /&gt;
&lt;br /&gt;
==== Other compositional analysis and quantification of bilberry anthocyanins ====&lt;br /&gt;
&lt;br /&gt;
The Journal of Agricultural and Food Chemistry has published a method of anthocyanin analysis in bilberry. That abstract can be accessed [http://pubs.acs.org/cgi-bin/abstract.cgi/jafcau/2004/52/i04/abs/jf034596w.html here]. &lt;br /&gt;
&lt;br /&gt;
A more recent paper published by the Journal of AOAC INTERNATIONAL “was developed and validated for the identification and quantification of both anthocyanins and anthocyanidins present in bilberry extracts and products.” The abstract for it is available [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.90.4.911 here].&lt;br /&gt;
&lt;br /&gt;
NUTRAfoods published a review of ten commercial bilberry extracts using USP/NF Pharmacopeial methods of analysis for anthocyanin content. Deficiences were noted in labeling and content of many products. That article can be accessed [http://www.ahpa.org/portals/0/pdfs/07_1000_Artaria_bilberry_extract_comparisons_Nutrafoods.pdf here].&lt;br /&gt;
&lt;br /&gt;
=== Acknowledgements ===&lt;br /&gt;
&lt;br /&gt;
AHPA appreciates the contributions of member companies MediHerb for the technical work and CAMAG Scientific Inc. for the HPTLC method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;br /&gt;
[[Category:Botanical]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)</id>
		<title>Citrus paradisi (seed)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)"/>
				<updated>2018-10-17T17:38:41Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Citrus paradisi'' (seed) }} {{askbox|herb=''Citrus paradisi''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Citrus x paradisi&lt;br /&gt;
|authority=Macfad.&lt;br /&gt;
|family=Rutaceae&lt;br /&gt;
|scn=grapefruit&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
|companyimage=Starr herbarium logo.png&lt;br /&gt;
| companyURL=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
|mainimage=Citrus paradisi Macfad. - Starr - v-162-01341949.jpg&lt;br /&gt;
|caption1=''Citrus paradisi'' Macfad.&lt;br /&gt;
|source=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
|}}&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Grapefruit (seed) (''Citrus paradisi'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Citrus paradisi seed - Alkemists Laboratories.jpg&lt;br /&gt;
             | caption1=''Citrus paradisi'' HPTLC ID - 10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=CHCl3: CH3OH: HCOOH: H2O [6/2/1.4/0.1]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicate/heat @ 50° C ~ 1/2 hr&lt;br /&gt;
             | detection=10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 3 μL Hesperidin, Hesperitin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Citrus paradisi''-1 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-2 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-4 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-5 (seed)&lt;br /&gt;
# 3 μL Naringin, Naringenin ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Method Developed by Alkemists Laboratories&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC-AHP-NCNPR Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=BAPP-logo-2018-2line-LOW2.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/GrapefruitSeedExtractLabGuidanceDocument.html&lt;br /&gt;
             | description=Grapefruit (seed extract) (''Citrus paradisi'')&lt;br /&gt;
             | characteristics=This ABC-AHP-NCNPR Botanical Adulterants Prevention Program  [http://cms.herbalgram.org/BAP/LGD/GrapefruitSeedExtractLabGuidanceDocument.html Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic grapefruit seed extract ingredients and non-authentic materials, with particular discussion of synthetic microbicidal compounds identified in non-authentic materials, authentic grapefruit seed extract components, and a detailed literature review of methods (including sample characterization via TLC, HPLC-UV, HPLC-MS, GC-MS, and others).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Scutellaria_lateriflora_(flower)</id>
		<title>Scutellaria lateriflora (flower)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Scutellaria_lateriflora_(flower)"/>
				<updated>2018-10-17T17:19:27Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Scuntellaria lateriflora'' (flower) }} {{askbox|herb=''Scutellaria lateriflora''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Scutellaria lateriflora&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Lamiaceae&lt;br /&gt;
|scn=skullcap&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=blue skullcap; scullcap&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2      | cat=Voucher&lt;br /&gt;
&lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Scutellaria_lateriflora_Tropicos_100007266.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100007266&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100007266&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | source2=Botanical Voucher Specimen Library, Alkemists Laboratories&lt;br /&gt;
             | image2=Scutellaria lateriflora LE31406JD A0272.jpg&lt;br /&gt;
             | companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Odor slight; taste slightly bitter. }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics= &lt;br /&gt;
&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=This plant is smooth or with very fine hair on the upper parts with slender, erect or declining, widely branched stems from one-third to 2 1/2 feet high.  The thin, slender-stemmed leaves are somewhat lance-shaped or egg-shaped, 1 to 3 inches long, and coarsely toothed.  The blue and whitish, tube shaped flowers appear from July to September.&lt;br /&gt;
}}&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''Scutellaria lateriflora'' is an indigenous, perennial herb, with a stem erect, much branched, quadrangular, smooth, and one or two feet high. The leaves are ovate, acute, dentate, subcordate upon the stem, opposite, and supported upon long petioles. The flowers are small, of a pale blue color, and disposed in long, lateral, 1-sided, leafy racemes. &lt;br /&gt;
&lt;br /&gt;
Dried tops are ... about 50 cm. in length, smooth; stem quadrangular, branched; leaves opposite, petiolate, about 5 cm. in length, ovate-lanceolate or ovate-oblong, serrate; flowers about 6 mm. in length, in axillary one-sided racemes, with a pale blue corolla and bilabiate calyx, closed in fruit, the upper lip helmet-shaped.}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 570.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 3067.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC-AHP-NCNPR Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=BAPP-logo-2018-2line-LOW2.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/SkullcapLabGuidanceDocument.html&lt;br /&gt;
             | description=Skullcap (herb) (''Scutellaria lateriflora'')&lt;br /&gt;
             | characteristics=This ABC-AHP-NCNPR Botanical Adulterants Prevention Program  [http://cms.herbalgram.org/BAP/LGD/SkullcapLabGuidanceDocument.html Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic skullcap ingredients and non-authentic materials, with particular discussion of ''Scutellaria'' and/or germander ''Teucrium'' substitutions.  Differences in flavonoid compositions are reviewed, and a variety of methods for authentication considered (including sample characterization via HPTLC, HPLC, UPLC, MS fingerprinting, NMR, and Near-IR hyperspectral imaging).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical  | source=AHPA Known Adulterants&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | description=Skullcap (flowering parts) (''Scutellaria lateriflora'')&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Germander (''Teucrium chamaedrys'') flowering parts.&lt;br /&gt;
               }}&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:ABC-AHP-NCNPR_Botanical_Adulterants_Prevention_Program</id>
		<title>Category:ABC-AHP-NCNPR Botanical Adulterants Prevention Program</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:ABC-AHP-NCNPR_Botanical_Adulterants_Prevention_Program"/>
				<updated>2018-10-17T17:16:44Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[File:BAPP-logo-2018-2line-LOW2.jpg||ABC-AHP-NCNPR Botanical Adulterants Prevention Program]]&lt;br /&gt;
&lt;br /&gt;
Three leading nonprofit organizations are cooperating in the Botanical Adulterants Prevention Program, a large-scale program to educate members of the herbal and dietary supplement industry about ingredient and product adulteration. Partners include the [http://abc.herbalgram.org/site/PageServer American Botanical Council] (ABC), the [http://www.herbal-ahp.org/ American Herbal Pharmacopoeia] (AHP), and the [http://pharmacy.olemiss.edu/ncnpr/ University of Mississippi's National Center for Natural Products Research] (NCNPR).&lt;br /&gt;
&lt;br /&gt;
The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants. ABC is an independent, nonprofit research and education organization dedicated to providing accurate and reliable information for consumers, healthcare practitioners, researchers, educators, industry and the media. education using science-based and traditional information to promote responsible use of herbal medicine — serving the public, researchers, educators, healthcare professionals, industry and media.&lt;br /&gt;
&lt;br /&gt;
From its headquarters at the Case Mill Homestead in Austin, Texas, ABC publishes HerbalGram, a peer-reviewed quarterly journal; HerbClip, a twice-monthly series of summaries and critical reviews of recently published herbal literature; HerbalEGram, a monthly electronic publication; Herbal News &amp;amp; Events, a weekly update on events and media; and the Botanical Monitor, a quarterly newsletter addressing botanical adulteration issues. ABC is also the publisher of four books, including The ABC Clinical Guide to Herbs, a continuing education and reference book, which contains extensive monographs on the safety and efficacy of 30 popular herbs.&lt;br /&gt;
&lt;br /&gt;
If you would like more information about the American Botanical Council and ABC's services, please [http://abc.herbalgram.org/site/PageServer?pagename=Contact_Us contact ABC here].&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Actaea_racemosa_(root_and_rhizome)</id>
		<title>Actaea racemosa (root and rhizome)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Actaea_racemosa_(root_and_rhizome)"/>
				<updated>2018-10-17T17:15:35Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Actaea racemosa'' (root and rhizome)}}  {{askbox|herb=''Actaea racemosa''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Actaea racemosa&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=black cohosh&lt;br /&gt;
|syn=''Cimicifuga racemosa'' (L.) Nutt.&lt;br /&gt;
|aka=black bugbane; black snakeroot; rheumatism weed&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{media3 |companyimage=TropicosLogo.gif&lt;br /&gt;
 | companyURL=http://www.tropicos.org/Image/100105518&lt;br /&gt;
 |mainimage=Actaea racemosa Tropicos 100105518.jpg&lt;br /&gt;
 |source=Tropicos.org. Missouri Botanical Garden. 05 Aug 2013&lt;br /&gt;
 |cat=Voucher&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
| companyimage2=Kewlogo.gif&lt;br /&gt;
| companyURL2=http://specimens.kew.org/herbarium/K000694465&lt;br /&gt;
| image2=Actaea_racemosa_Kew_imageBarcode=K000694465_306208.jpg&lt;br /&gt;
| source2=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
| companyimage3=Kewlogo.gif&lt;br /&gt;
| companyURL3=http://specimens.kew.org/herbarium/K000694466&lt;br /&gt;
| image3=Actaea_racemosa_Kew_imageBarcode=K000694466_306208.jpg&lt;br /&gt;
| source3=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Rhizome externally dark brown; internally whitish and mealy or dark brown and waxy; odor slight; taste bitter and acrid. &lt;br /&gt;
&lt;br /&gt;
Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown; internally bark dark brown, wood yellowish.  The odor, though not strong, is peculiar and rather disagreeable, and is gradually lost with age.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;... [A] tall stately plant, having a perennial root, and a simple herbaceous stem, which rises from four to eight feet in height. The leaves are large, and ternately decompound, having oblong-ovate leaflets, incised and toothed at their edges. The flowers are small, white, and disposed in a long, terminal, wand-like raceme, with occasionally one or two shorter racemes near its base. The calyx is white, four-leaved, and deciduous; the petals are minute, and shorter than the stamens; the pistil consists of an oval ovary and sessile stigma. The fruit is an ovoid capsule containing numerous flat seeds. &lt;br /&gt;
&lt;br /&gt;
&amp;quot;Rhizome horizontal, more or less branching, from 2 to 12 cm. in length, and from 1 to 2.5 cm. in thickness; externally dark brown, slightly annulate from circular scars of bud scale-leaves, the upper surface with numerous stout, erect or somewhat curved branches terminated by deep, cup-shaped sears, each of which usually shows a distinct radiate structure; inferior and lateral portions with numerous root-scars and a few short roots; fracture horny; internally whitish and mealy or dark brown and waxy, bark thin, wood distinctly radiate and of about the same thickness as the pith... Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown, longitudinally wrinkled; fracture short; internally bark dark brown, wood yellowish, 4 to 6-rayed.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |mainimage=2013 BC Cut and Sifted AHPA.JPG&lt;br /&gt;
 |source=AHPA.org. Raw material sample. (2013)&lt;br /&gt;
 |cat=Macroscopic&lt;br /&gt;
&lt;br /&gt;
|companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
|image2=Alkemists_Actaea_racemosa_macro.jpg&lt;br /&gt;
           |caption2=Root, cut and sifted&lt;br /&gt;
           |source2=Alkemist Laboratories&lt;br /&gt;
&lt;br /&gt;
|companyimage3=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL3=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |image3=2014 BC SE Kentucky AHPA.JPG&lt;br /&gt;
 |source3=AHPA.org. Raw material sample. (2014)}}&lt;br /&gt;
&lt;br /&gt;
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |mainimage=2014 BC SE Missouri AHPA.JPG&lt;br /&gt;
 |source=AHPA.org. Raw material sample. (2014)&lt;br /&gt;
 |cat=Macroscopic&lt;br /&gt;
&lt;br /&gt;
| companyimage2=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
| companyURL2=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
| image2=2014 BC Virginia AHPA.JPG&lt;br /&gt;
| source2=AHPA.org. Raw material sample. (2014) &lt;br /&gt;
&lt;br /&gt;
| companyimage3=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
| companyURL3=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
| image3=2014 BC W. Virginia AHPA.JPG&lt;br /&gt;
| source3=AHPA.org. Raw material sample. (2014) &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Microscopy| source=United States Dispensatory (1918)&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Under the microscope, sections of the rhizome ... show a yellowish-brown suberized epidermis, a cortex made up of about 30 layers of starch-bearing parenchyma cells; the fibro-vascular bundles collateral, the xylem consisting of tracheae with bordered pores, and resembling tracheids in that the ends are rather acute; wood-fibers numerous, thin-walled, strongly lignified and with simple, oblique pores, the bundles separated by starch-bearing parenchyma strands from 5 to 30 cells wide; pith cells numerous, resembling those of the cortex. &lt;br /&gt;
&lt;br /&gt;
&amp;quot;... sections of the root ... show a hairy epidermis, which becomes suberized in older roots; the cortex shows about 12 rows of starch-bearing parenchyma cells; endodermis distinct; fibro-vascular bundles 4 to 6, showing in older roots as separate collateral bundles. The powder is light to dark brown; starch grains numerous, single or compound, the individual grains spherical or more or less polygonal, each with a somewhat central cleft, from 0.003 to 0.015 mm. in diameter; fragments showing trachea with bordered pores and lignified wood-fibers; irregular, yellowish-brown fragments of suberized epidermis made up of more or less tabular cells, sometimes elongated and considerably thickened.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
{{media |cat=Microscopy&lt;br /&gt;
|companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
|mainimage=Alkemists Actaea racemosa brown suberized cells.png&lt;br /&gt;
            | caption1=Brown suberized cells (400X, Acidified chloral hydrate solution)&lt;br /&gt;
           |source=Elan M. Sudberg, Alkemist Laboratories}}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=AHPA Practical, CAMAG HPTLC&lt;br /&gt;
             | companyimage=Camag_logo.png&lt;br /&gt;
             | companyURL=http://www.camag.com/&lt;br /&gt;
             | mainimage=Camag-blackcohosh-1-d-uv254.png&lt;br /&gt;
             | caption1=Black cohosh HPTLC ID - Developed, UV 254 nm&lt;br /&gt;
             | description=Black cohosh (root) (''Actaea racemosa'')&lt;br /&gt;
             | image2=Camag-blackcohosh-1-d-uv366.png&lt;br /&gt;
             | caption2=Black cohosh HPTLC ID - Developed, UV 366 nm&lt;br /&gt;
             | image3=Camag-blackcohosh-1-H2SO4-uv366.png&lt;br /&gt;
             | caption3=Black cohosh HPTLC ID - Sulfuric acid reagent, UV 366 nm&lt;br /&gt;
             | image4=Camag-blackcohosh-1-H2SO4-whiteRT.png&lt;br /&gt;
             | caption4=Black cohosh HPTLC ID Method - Sulfuric acid reagent, white RT &lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Stationary phase, i.e. Silica gel 60, F254&lt;br /&gt;
             | mobilephase=Toluene, ethyl formate, formic acid 50:30:20 (v/v/v)&lt;br /&gt;
             | prep=Sample: Mix 0.5 g of powdered sample with 10 mL of an ethanolwater&lt;br /&gt;
mixture (1:1) and sonicate for 10 minutes, then&lt;br /&gt;
centrifuge or filter the solutions and use the&lt;br /&gt;
supernatants/filtrates as test solutions.&lt;br /&gt;
&lt;br /&gt;
Sulfuric Acid Reagent: Preparation: 20 mL of sulfuric acid are mixed with 180 mL&lt;br /&gt;
of ice-cooled methanol&lt;br /&gt;
             | detection=UV/Vis, Sulfuric Acid Reagent Use: Dip (time 0, speed 5), heat at 100°C for 5 min&lt;br /&gt;
             | referencesamples=Reference: Dissolve 1mg of actein, 23-epi-26-deoxyactein, isoferulic&lt;br /&gt;
acid, cimifugin and/or norcimifugin individually in 10 mL&lt;br /&gt;
of methanol.&lt;br /&gt;
             |&lt;br /&gt;
             | lanes=Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Isoferulic acid&lt;br /&gt;
# 2 μL Norcimifugin&lt;br /&gt;
# 2 μL Actein&lt;br /&gt;
# 2 μL 23-epi-26-Deoxyactein&lt;br /&gt;
# 2 μL Cimifugin&lt;br /&gt;
# 2 μL ''C. racemosa''&lt;br /&gt;
# 2 μL ''C. racemosa''&lt;br /&gt;
# 2 μL ''C. foetida''&lt;br /&gt;
# 2 μL ''C. heracleifolia''&lt;br /&gt;
# 2 μL ''C. dahurica''&lt;br /&gt;
# 2 μL ''C. americana''&lt;br /&gt;
             | notes=Compare result under UV 254 nm and white RT with reference images in Image Comparison&lt;br /&gt;
Viewer. The fingerprint of the test solution is similar to that of the corresponding botanical reference&lt;br /&gt;
sample. Additional weak zones may be present.&lt;br /&gt;
&lt;br /&gt;
''C. racemosa'' Identification: Under UV 254 nm the chromatogram obtained with the test solution does not&lt;br /&gt;
show a dark zone at the position of Cimifugin in the reference solution or just&lt;br /&gt;
above it.&lt;br /&gt;
Under white RT a characteristic fingerprint is detected. Below Cimifugin there&lt;br /&gt;
are two violet zones. Just above the application position two brown zones are&lt;br /&gt;
detected (blue arrow).&lt;br /&gt;
There is no brown zone at the position of Cimifugin, but there might be a faint&lt;br /&gt;
violet zone. There is a brown zone at the position of actein as well as two&lt;br /&gt;
brown zone just below. Just above the actein zone is a very thin brown zone&lt;br /&gt;
(green arrow).&lt;br /&gt;
&lt;br /&gt;
Further methodology available here, in [http://www.ahpa.org/portals/0/pdfs/Black_cohosh_ID_Method.pdf Identification of black cohosh by HPTLC].&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
[[Category:DNA]]&lt;br /&gt;
{| border=1&lt;br /&gt;
|[[File:NY_Botanical_Garden_logo.png|right|150x75px]]&lt;br /&gt;
'''Black Cohosh (''Actaea racemosa'')'''&lt;br /&gt;
&lt;br /&gt;
'''Amplification primers:''' &lt;br /&gt;
&lt;br /&gt;
NY1400 (5′-CAT TTT CTT GAT TTT CTG GGC TA-3′) and NY1401 (5′-CCG GCT TAC TAA TGG GAT G-3′)&lt;br /&gt;
&lt;br /&gt;
'''PCR reaction mixture:'''&lt;br /&gt;
&lt;br /&gt;
15 µL final volume containing 1.5 µL PCR buffer (200 mM tris [pH 8.8], 100 mM KCl, 100 mM (NH&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;)&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;SO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;, 20 mM MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;, 1% [v/v] Triton X-100, 50% [w/v] sucrose, 0.25% [w/v] cresol red), 0.2 µM dNTPs, 0.025 μg/μL bovine serum albumin (BSA), 1 μM of each primer, 0.25 units of ''Taq'' polymerase, and 0.5 µL template DNA.&lt;br /&gt;
&lt;br /&gt;
'''PCR program:''' 95°C for 2.5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, 72°C for 30 s; 72°C for 10 min. &lt;br /&gt;
&lt;br /&gt;
'''Sequencing primers:''' Same as amplification primers.&lt;br /&gt;
&lt;br /&gt;
'''Sequence:''' &lt;br /&gt;
5′-TCT TTC AAG TGT ACG AAA AAA TCC TTC GGT GGT AAG GAG TCA AAT GTT AGA AAA TTC ATT TAT TAT AGA CAT TGC TAT TAA TAA GTT TGA TAC TAT AGT CCC AAT TAT TCC TTT GAT TGG ATT ATT GGC TAA AGC GAA ATT TTG TAA CTT ATC GGG G-3′&lt;br /&gt;
&lt;br /&gt;
'''Diagnostic positions:'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;               0000011111222222233334444444455566667&lt;br /&gt;
               1567946789023444705590004567900501130&lt;br /&gt;
               2669211792396679602777892010701063662&lt;br /&gt;
A. arizonica   GACAGCCCCCGTATTTCCGCACATTACGCTCACTACG&lt;br /&gt;
A. asiatica    ........T........TA.G...........T....&lt;br /&gt;
A. biternata   ----....T......G..AT............T..TT&lt;br /&gt;
A. cimicifuga  TG......T.........A.....C......GT.G..&lt;br /&gt;
A. cordifolia  .....................................&lt;br /&gt;
A. dahurica    ---.....TT........A....CC..T...GT.G..&lt;br /&gt;
A. elata       .......T..........AT..G.....G........&lt;br /&gt;
A. pachypoda   ........T........TA.............T....&lt;br /&gt;
A. podocarpa   .......T...C......AT......A..........&lt;br /&gt;
A. racemosa    ...M....T........TA..........AA.T....&lt;br /&gt;
A. rubra       -.......T........TA.R...........T....&lt;br /&gt;
A. simplex     TRM.....T.......M.A..M..C.Y.S..GT.G..&lt;br /&gt;
A. spicata     ........T........TA.............TG...&lt;br /&gt;
A. vaginata    ...-AGA.T.A.TGG...A.GA...C.T....T....&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
== ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC-AHP-NCNPR Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=BAPP-logo-2018-2line-LOW2.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html&lt;br /&gt;
             | description=Black cohosh (root and rhizome) (''Actaea racemosa'')&lt;br /&gt;
             | characteristics=This ABC-AHP-NCNPR Botanical Adulterants Prevention Program [http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html black cohosh Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic black cohosh ingredients and non-authentic materials, with particular discussion of other species of ''Actaea'' and other plants also known in China as ''sheng ma''-type species, phenolic acid profiles, and a detailed literature review of methods (including sample characterization via HPLC, HPTLC, MS, and NMR).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical | source=AHPA Known Adulterants&lt;br /&gt;
             | description=Black cohosh (root) (''Actaea racemosa'', syn ''Cimicifuga racemosa'')&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Chinese cimicifuga (root) (''Actaea'' spp.).  Also known as ''sheng ma'' or Rhizoma Cimicifugae; consists of ''Actaea cimicifuga'', syn. ''Cimicifuga foetida''; ''Actaea dahurica'', syn. ''C. dahurica''; ''A. heracleifolia'', syn. ''C. heracleifolia''; and possibly other Asian species of ''Actaea''.&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== AHPA Practical: Detecting Adulteration of Black cohosh root/rhizome ==&lt;br /&gt;
[[Category:AHPA Practicals]]&lt;br /&gt;
[[File:AHPA Logo.gif|right|150x75px|link=http://www.ahpa.org/]]&lt;br /&gt;
Reproduced from [http://www.ahpa.org/Default.aspx?tabid=170].&lt;br /&gt;
===Introduction===&lt;br /&gt;
The American Herbal Products Association is providing here analytical tools and methods to identify adulteration of raw materials and dietary ingredients labeled as black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') root/rhizome, or extracts thereof. This information is provided for industry in order to deal appropriately with reports of adulteration of this ingredient and make wise purchasing decisions.&lt;br /&gt;
===Background===&lt;br /&gt;
The economic adulteration of black cohosh root and rhizome with other species is well established. AHPA’s guidance policy on [http://www.ahpa.org/Default.aspx?tabid=223 Known Adulterants] identifies Chinese cimicifuga root/rhizome, also known as ''sheng ma'' or Rhizoma Cimicifugae as known black cohosh adulterants. This material commonly consists of ''Actaea cimicifuga'', syn. ''Cimicifuga foetida''; ''Actaea dahurica'', syn. ''C. dahurica''; ''A. heracleifolia'', syn. ''C. heracleifolia''; and possibly other Asian species of ''Actaea''. The citation below provides a review of Rhizoma Cimicifugae for those wanting additional information.&lt;br /&gt;
&lt;br /&gt;
Li JX, Yu ZY. [http://www.benthamscience.com/cmc/contabs/cmc13-24.htm#7 Cimicifugae rhizoma: from origins, bioactive constituents to clinical outcomes.] ''Curr Med Chem''. 2006;13(24):2927-51.&lt;br /&gt;
&lt;br /&gt;
The black cohosh monograph in the ''Natural Health Ingredients Database'' of the Canadian Natural Health Products Directorate at Health Canada, available online [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/monoReq.do?id=44&amp;amp;lang=eng here] or as a pdf file [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/dbImages/559 here], references instances where adverse events associated with ingestion of products labeled as containing black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') were found to contain plant species that were not black cohosh upon laboratory analysis. The ''Canadian Adverse Reaction Newsletter'' ([http://www.hc-sc.gc.ca/dhp-mps/alt_formats/pdf/medeff/bulletin/carn-bcei_v20n1-eng.pdf 2010 Jan;20(1):1-2]) provided specifics on this situation as covered in a [http://www.ahpa.org/Default.aspx?tabid=69&amp;amp;aId=568&amp;amp;zId=1 January 14, 2010 AHPA Update].&lt;br /&gt;
&lt;br /&gt;
===Analytical tools===&lt;br /&gt;
There are several analytical tools available for the authentication of genuine black cohosh and its differentiation from other species. Two papers detailing the use of high performance thin-layer chromatography (HPTLC) are cited below. The first focuses on detection of black cohosh adulteration by other North American Actaea species while the second deals more specifically with differentiation of black cohosh from Chinese cimicifuga. The full methodology for the HPTLC analysis of the second citation can be accessed via this: [http://www.ahpa.org/portals/0/pdfs/Black_cohosh_ID_Method.pdf Identification of black cohosh by HPTLC].&lt;br /&gt;
&lt;br /&gt;
The third citation below employed phytochemical “fingerprinting” using high-performance liquid chromatography with a photo-diode array detector (HPLC-PDA) and liquid chromatography with mass spectrometry detection (LC-MS) to authenticate black cohosh and differentiate it from 14 other Actaea species.&lt;br /&gt;
====HPTLC Methods====&lt;br /&gt;
Verbitski SM, Gourdin GT, Ikenouye LM, McChesney JD, Hildreth J. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.2.268 Detection of Actaea racemosa adulteration by thin-layer chromatography and combined thin-layer chromatography-bioluminescence.] J AOAC Int. 2008 Mar-Apr;91(2):268-75.&lt;br /&gt;
&lt;br /&gt;
Ankli A, Reich E, Steiner M. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.6.1257 Rapid high-performance thin-layer chromatographic method for detection of 5% adulteration of black cohosh with ''Cimicifuga foetida'', ''C. heracleifolia'', ''C. dahurica'', or ''C. americana''.] J AOAC Int. 2008 Nov-Dec;91(6):1257-64.&lt;br /&gt;
====HPLC Method====&lt;br /&gt;
[[Category:HPLC]]&lt;br /&gt;
Jiang B, Ma C, Motley T, Kronenberg F, Kennelly EJ. [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/abstract Phytochemical fingerprinting to thwart black cohosh adulteration: a 15 ''Actaea'' species analysis.] Phytochem Anal. 2011 Feb 19. doi: 10.1002/pca.1285. [Epub ahead of print] Supporting information is available [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/suppinfo here]. &lt;br /&gt;
&lt;br /&gt;
The black cohosh monograph in the ''Natural Health Ingredients Database'' of the Canadian Natural Health Products Directorate at Health Canada, available online [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/monoReq.do?id=44&amp;amp;lang=eng here] or as a pdf file [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/dbImages/559 here], references instances where adverse events associated with ingestion of products labeled as containing black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') were found to contain plant species that were not black cohosh upon laboratory analysis. The ''Canadian Adverse Reaction Newsletter'' ([http://www.hc-sc.gc.ca/dhp-mps/alt_formats/pdf/medeff/bulletin/carn-bcei_v20n1-eng.pdf 2010 Jan;20(1):1-2]) provided specifics on this situation as covered in a [http://www.ahpa.org/Default.aspx?tabid=69&amp;amp;aId=568&amp;amp;zId=1 January 14, 2010 AHPA Update].&lt;br /&gt;
&lt;br /&gt;
The [http://www.herbal-ahp.org/order_online.htm American Herbal Pharmacopoeia] and the [http://www.usp.org/products/dsc/ USP Dietary Supplements Compendium] also contain useful information for the differentiation of black cohosh and other species representing common black cohosh adulterants. Authenticated black cohosh reference materials are available from both organizations as well as AHPA member companies [http://www.alkemist.com/ Alkemists Laboratories], [http://www.botanicalliaisons.com/ Botanical Liaisons], and [http://www.chromadex.com/ Chromadex]. DNA testing can be used to verify authentic species, and rule out the presence of common or other unexpected DNA-containing adulterants or contaminants. Work in this area is currently being conducted by AHPA member [http://www.authentechnologies.com/ AuthenTechnologies].&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
===NMR Barcoding, Qiu, ''et al.'', 2014===&lt;br /&gt;
'''2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes,''' &lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
The interpretation of NMR spectroscopic information for structure elucidation involves decoding of complex resonance patterns that contain valuable molecular information (δ and J), which is not readily accessible otherwise. We introduce a new concept of 2D-NMR barcoding that uses clusters of fingerprint signals and their spatial relationships in the δ−δ coordinate space to facilitate the chemical identification of complex mixtures. Similar to widely used general barcoding technology, the structural information of individual compounds is encoded as a specifics pattern of their C,H correlation signals. Software-based recognition of these patterns enables the structural identification of the compounds and their discrimination in mixtures. Using the triterpenes from various Actaea (syn. Cimicifuga) species as a test case, heteronuclear multiple-bond correlation (HMBC) barcodes were generated on the basis of their structural subtypes from a statistical investigation of their δH and δC data in the literature. These reference barcodes allowed in silico identification of known triterpenes in enriched fractions obtained from an extract of A. racemosa (black cohosh). After dereplication, a differential analysis of heteronuclear single-quantum correlation (HSQC) spectra even allowed for the discovery of a new triterpene. The 2D barcoding concept has potential application in a natural product discovery project, allowing for the rapid dereplication of known compounds and as a tool in the search for structural novelty within compound classes with established barcodes.&amp;lt;ref&amp;gt;&lt;br /&gt;
    Qiu, F., McAlpine, J.B., Lankin, D.C., Burton, I., Karakach, T., Chen, S., Pauli G.F. 2014. 2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes  ''Analytical Chemistry''  86(8), 3964-3972. http://pubs.acs.org/doi/abs/10.1021/ac500188j&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Countercurrent Chromatography, Cicek, ''et al.'', 2010===&lt;br /&gt;
'''Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection.'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
In the present work, a fast and simple method for the separation and purification of triterpene saponins from Actaea racemosa was successfully established. Accelerated solvent extraction was used for defatting and extracting of the subaerial parts, giving a triterpene enriched crude extract. Size exclusion chromatography was used to separate actein and 23-epi-26-deoxyactein from other triterpenoids, which were collected in a third fraction. This most complex third fraction was applied to high-speed countercurrent chromatography, a well-established technique for the separation of saponins. Separation parameters were first optimized on an analytical level, using a hyphenated HSCCC-ELSD setup, before the system was scaled up to preparative size. The resulting two-phase solvent system, consisting of N-hexane-acetone-ethyl acetate-2-propanol-ethanol-water (3.5 : 1 : 2 : 1 : 0.5 : 2, v/v/v/v/v/v), enabled the isolation of 23-O-acetylshengmanol-3-O- beta-D-xylopyranoside (17.4 mg), cimiracemoside D (19.5 mg), 25-O-acetylcimigenol-3-O-beta-D-xylopyranoside (7.1 mg) and the aglycone cimigenol (5.9 mg). Purity of the isolated substances was 96.8 %, 96.2 %, 97.9 %, and 98.4 %, respectively. The same method was suitable for the purification of actein and 23-epi-26-deoxyactein, with purities of 97.0 % and 98.3 %.&amp;lt;ref&amp;gt;&lt;br /&gt;
Cicek, S.S., Schwaiger, S., Ellmerer, E.P., Stuppner, H. 2010. Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection. ''Planta Med.'' 76(5):467-73.  http://www.ncbi.nlm.nih.gov/pubmed/19847744&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===HPLC/MS analysis, Liu, ''et al.'', 2003===&lt;br /&gt;
[[Category:HPLC]]&lt;br /&gt;
'''Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry.'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
Caffeic acid derivatives occurring in black cohosh [Cimicifuga racemosa (L.) Nutt., Actaea racemosa (Ranunculaceae)], some of which may have pharmacological activity, were analyzed using high-performance liquid chromatography (HPLC) electrospray ionization tandem mass spectrometry (ESI-MS/MS) with the aim of developing a methodology for their rapid identification in a complex plant matrix. Based on these studies, structurally characteristic product ions and neutral molecule losses were identified, which were then used during LC/MS/MS with product ion scanning, precursor scanning and constant neutral loss scanning to detect caffeic acid derivatives in a crude extract of black cohosh. Several caffeic acid derivatives were detected, and the identification of six of them were confirmed by comparison with authentic standards including caffeic acid, ferulic acid, isoferulic acid, fukinolic acid, cimicifugic acid A, and cimicifugic acid B. Four other compounds were detected that appeared to be caffeic acid derivatives based on LC/MS/MS retention times, molecular weights, and fragmentation patterns during MS/MS. Since standards were unavailable for these four compounds, they were tentatively identified using LC/MS/MS as cimicifugic acid E, cimicifugic acid F, dehydrocimicifugic acid A, and dehydrocimicifugic acid B. Dehydrocimicifugic acid A and dehydrocimicifugic acid B have not been reported previously to be constituents of black cohosh.&amp;lt;ref&amp;gt;&lt;br /&gt;
Liu, W., Sun, Y., Liang, W., Fitzloff, J.F., van Breemen, R.B. 2003. Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry. ''Rapid Commun Mass Spectrom.'' 17(9):978-82.  http://www.ncbi.nlm.nih.gov/pubmed/12717772&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Scutellaria_lateriflora_(flower)</id>
		<title>Scutellaria lateriflora (flower)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Scutellaria_lateriflora_(flower)"/>
				<updated>2018-10-12T21:05:26Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add summary and link to ABC BAPP Lab Guidance */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Scuntellaria lateriflora'' (flower) }} {{askbox|herb=''Scutellaria lateriflora''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Scutellaria lateriflora&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Lamiaceae&lt;br /&gt;
|scn=skullcap&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=blue skullcap; scullcap&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2      | cat=Voucher&lt;br /&gt;
&lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Scutellaria_lateriflora_Tropicos_100007266.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100007266&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100007266&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | source2=Botanical Voucher Specimen Library, Alkemists Laboratories&lt;br /&gt;
             | image2=Scutellaria lateriflora LE31406JD A0272.jpg&lt;br /&gt;
             | companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Odor slight; taste slightly bitter. }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics= &lt;br /&gt;
&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=This plant is smooth or with very fine hair on the upper parts with slender, erect or declining, widely branched stems from one-third to 2 1/2 feet high.  The thin, slender-stemmed leaves are somewhat lance-shaped or egg-shaped, 1 to 3 inches long, and coarsely toothed.  The blue and whitish, tube shaped flowers appear from July to September.&lt;br /&gt;
}}&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''Scutellaria lateriflora'' is an indigenous, perennial herb, with a stem erect, much branched, quadrangular, smooth, and one or two feet high. The leaves are ovate, acute, dentate, subcordate upon the stem, opposite, and supported upon long petioles. The flowers are small, of a pale blue color, and disposed in long, lateral, 1-sided, leafy racemes. &lt;br /&gt;
&lt;br /&gt;
Dried tops are ... about 50 cm. in length, smooth; stem quadrangular, branched; leaves opposite, petiolate, about 5 cm. in length, ovate-lanceolate or ovate-oblong, serrate; flowers about 6 mm. in length, in axillary one-sided racemes, with a pale blue corolla and bilabiate calyx, closed in fruit, the upper lip helmet-shaped.}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 570.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 3067.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC, Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=ABC-logo-horiz.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/SkullcapLabGuidanceDocument.html&lt;br /&gt;
             | description=Skullcap (herb) (''Scutellaria lateriflora'')&lt;br /&gt;
             | characteristics=This [http://cms.herbalgram.org/BAP/LGD/SkullcapLabGuidanceDocument.html ABC BAPP Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic skullcap ingredients and non-authentic materials, with particular discussion of ''Scutellaria'' and/or germander ''Teucrium'' substitutions.  Differences in flavonoid compositions are reviewed, and a variety of methods for authentication considered (including sample characterization via HPTLC, HPLC, UPLC, MS fingerprinting, NMR, and Near-IR hyperspectral imaging).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical  | source=AHPA Known Adulterants&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | description=Skullcap (flowering parts) (''Scutellaria lateriflora'')&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Germander (''Teucrium chamaedrys'') flowering parts.&lt;br /&gt;
               }}&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)</id>
		<title>Citrus paradisi (seed)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)"/>
				<updated>2018-10-12T20:01:13Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* correct BAPP link to Lab Guidance Document in Supplementary section */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Citrus paradisi'' (seed) }} {{askbox|herb=''Citrus paradisi''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Citrus x paradisi&lt;br /&gt;
|authority=Macfad.&lt;br /&gt;
|family=Rutaceae&lt;br /&gt;
|scn=grapefruit&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
|companyimage=Starr herbarium logo.png&lt;br /&gt;
| companyURL=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
|mainimage=Citrus paradisi Macfad. - Starr - v-162-01341949.jpg&lt;br /&gt;
|caption1=''Citrus paradisi'' Macfad.&lt;br /&gt;
|source=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
|}}&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Grapefruit (seed) (''Citrus paradisi'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Citrus paradisi seed - Alkemists Laboratories.jpg&lt;br /&gt;
             | caption1=''Citrus paradisi'' HPTLC ID - 10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=CHCl3: CH3OH: HCOOH: H2O [6/2/1.4/0.1]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicate/heat @ 50° C ~ 1/2 hr&lt;br /&gt;
             | detection=10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 3 μL Hesperidin, Hesperitin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Citrus paradisi''-1 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-2 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-4 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-5 (seed)&lt;br /&gt;
# 3 μL Naringin, Naringenin ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Method Developed by Alkemists Laboratories&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC, Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=ABC-logo-horiz.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/GrapefruitSeedExtractLabGuidanceDocument.html&lt;br /&gt;
             | description=Grapefruit (seed extract) (''Citrus paradisi'')&lt;br /&gt;
             | characteristics=This [http://cms.herbalgram.org/BAP/LGD/GrapefruitSeedExtractLabGuidanceDocument.html ABC BAPP Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic grapefruit seed extract ingredients and non-authentic materials, with particular discussion of synthetic microbicidal compounds identified in non-authentic materials, authentic grapefruit seed extract components, and a detailed literature review of methods (including sample characterization via TLC, HPLC-UV, HPLC-MS, GC-MS, and others).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:ABC,_Botanical_Adulterants_Prevention_Program</id>
		<title>Category:ABC, Botanical Adulterants Prevention Program</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:ABC,_Botanical_Adulterants_Prevention_Program"/>
				<updated>2018-10-12T19:29:19Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* clean up grammar for contact link */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[File:BAPP-logo-2018-2line-LOW2.jpg||Botanical Adulterants Prevention Program]]&lt;br /&gt;
&lt;br /&gt;
Three leading nonprofit organizations are cooperating in the Botanical Adulterants Prevention Program, a large-scale program to educate members of the herbal and dietary supplement industry about ingredient and product adulteration. Partners include the [http://abc.herbalgram.org/site/PageServer American Botanical Council] (ABC), the [http://www.herbal-ahp.org/ American Herbal Pharmacopoeia] (AHP), and the [http://pharmacy.olemiss.edu/ncnpr/ University of Mississippi's National Center for Natural Products Research] (NCNPR).&lt;br /&gt;
&lt;br /&gt;
The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants. ABC is an independent, nonprofit research and education organization dedicated to providing accurate and reliable information for consumers, healthcare practitioners, researchers, educators, industry and the media. education using science-based and traditional information to promote responsible use of herbal medicine — serving the public, researchers, educators, healthcare professionals, industry and media.&lt;br /&gt;
&lt;br /&gt;
From its headquarters at the Case Mill Homestead in Austin, Texas, ABC publishes HerbalGram, a peer-reviewed quarterly journal; HerbClip, a twice-monthly series of summaries and critical reviews of recently published herbal literature; HerbalEGram, a monthly electronic publication; Herbal News &amp;amp; Events, a weekly update on events and media; and the Botanical Monitor, a quarterly newsletter addressing botanical adulteration issues. ABC is also the publisher of four books, including The ABC Clinical Guide to Herbs, a continuing education and reference book, which contains extensive monographs on the safety and efficacy of 30 popular herbs.&lt;br /&gt;
&lt;br /&gt;
If you would like more information about the American Botanical Council and ABC's services, please [http://abc.herbalgram.org/site/PageServer?pagename=Contact_Us contact ABC here].&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:ABC,_Botanical_Adulterants_Prevention_Program</id>
		<title>Category:ABC, Botanical Adulterants Prevention Program</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:ABC,_Botanical_Adulterants_Prevention_Program"/>
				<updated>2018-10-12T19:28:20Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* BAPP logo / project listing page description derived from ABC homepage for the project */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[File:BAPP-logo-2018-2line-LOW2.jpg||Botanical Adulterants Prevention Program]]&lt;br /&gt;
&lt;br /&gt;
Three leading nonprofit organizations are cooperating in the Botanical Adulterants Prevention Program, a large-scale program to educate members of the herbal and dietary supplement industry about ingredient and product adulteration. Partners include the [http://abc.herbalgram.org/site/PageServer American Botanical Council] (ABC), the [http://www.herbal-ahp.org/ American Herbal Pharmacopoeia] (AHP), and the [http://pharmacy.olemiss.edu/ncnpr/ University of Mississippi's National Center for Natural Products Research] (NCNPR).&lt;br /&gt;
&lt;br /&gt;
The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants. ABC is an independent, nonprofit research and education organization dedicated to providing accurate and reliable information for consumers, healthcare practitioners, researchers, educators, industry and the media. education using science-based and traditional information to promote responsible use of herbal medicine — serving the public, researchers, educators, healthcare professionals, industry and media.&lt;br /&gt;
&lt;br /&gt;
From its headquarters at the Case Mill Homestead in Austin, Texas, ABC publishes HerbalGram, a peer-reviewed quarterly journal; HerbClip, a twice-monthly series of summaries and critical reviews of recently published herbal literature; HerbalEGram, a monthly electronic publication; Herbal News &amp;amp; Events, a weekly update on events and media; and the Botanical Monitor, a quarterly newsletter addressing botanical adulteration issues. ABC is also the publisher of four books, including The ABC Clinical Guide to Herbs, a continuing education and reference book, which contains extensive monographs on the safety and efficacy of 30 popular herbs.&lt;br /&gt;
&lt;br /&gt;
If you would like more information about the American Botanical Council and the services we provide, please [http://abc.herbalgram.org/site/PageServer?pagename=Contact_Us contact us here].&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:BAPP-logo-2018-2line-LOW2.jpg</id>
		<title>File:BAPP-logo-2018-2line-LOW2.jpg</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:BAPP-logo-2018-2line-LOW2.jpg"/>
				<updated>2018-10-12T19:25:12Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Three leading nonprofit organizations are cooperating in the Botanical Adulterants Prevention Program, a large-scale program to educate members of the herbal and dietary supplement industry about ingredient and product adulteration. Partners include th...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Three leading nonprofit organizations are cooperating in the Botanical Adulterants Prevention Program, a large-scale program to educate members of the herbal and dietary supplement industry about ingredient and product adulteration. Partners include the [http://abc.herbalgram.org/site/PageServer American Botanical Council] (ABC), the [http://www.herbal-ahp.org/ American Herbal Pharmacopoeia] (AHP), and the [http://pharmacy.olemiss.edu/ncnpr/ University of Mississippi's National Center for Natural Products Research] (NCNPR).&lt;br /&gt;
&lt;br /&gt;
The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants. ABC is an independent, nonprofit research and education organization dedicated to providing accurate and reliable information for consumers, healthcare practitioners, researchers, educators, industry and the media. education using science-based and traditional information to promote responsible use of herbal medicine — serving the public, researchers, educators, healthcare professionals, industry and media.&lt;br /&gt;
&lt;br /&gt;
From its headquarters at the Case Mill Homestead in Austin, Texas, ABC publishes HerbalGram, a peer-reviewed quarterly journal; HerbClip, a twice-monthly series of summaries and critical reviews of recently published herbal literature; HerbalEGram, a monthly electronic publication; Herbal News &amp;amp; Events, a weekly update on events and media; and the Botanical Monitor, a quarterly newsletter addressing botanical adulteration issues. ABC is also the publisher of four books, including The ABC Clinical Guide to Herbs, a continuing education and reference book, which contains extensive monographs on the safety and efficacy of 30 popular herbs.&lt;br /&gt;
&lt;br /&gt;
If you would like more information about the American Botanical Council and the services we provide, please [http://abc.herbalgram.org/site/PageServer?pagename=Contact_Us contact us here].&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)</id>
		<title>Citrus paradisi (seed)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Citrus_paradisi_(seed)"/>
				<updated>2018-10-12T19:18:59Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add summary and link to ABC BAPP Lab Guidance for grapeseed extract */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Citrus paradisi'' (seed) }} {{askbox|herb=''Citrus paradisi''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Citrus x paradisi&lt;br /&gt;
|authority=Macfad.&lt;br /&gt;
|family=Rutaceae&lt;br /&gt;
|scn=grapefruit&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
|companyimage=Starr herbarium logo.png&lt;br /&gt;
| companyURL=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
|mainimage=Citrus paradisi Macfad. - Starr - v-162-01341949.jpg&lt;br /&gt;
|caption1=''Citrus paradisi'' Macfad.&lt;br /&gt;
|source=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
|}}&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Grapefruit (seed) (''Citrus paradisi'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Citrus paradisi seed - Alkemists Laboratories.jpg&lt;br /&gt;
             | caption1=''Citrus paradisi'' HPTLC ID - 10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=CHCl3: CH3OH: HCOOH: H2O [6/2/1.4/0.1]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicate/heat @ 50° C ~ 1/2 hr&lt;br /&gt;
             | detection=10% Ethanolic H2SO4-&amp;gt; 115° C 15 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 3 μL Hesperidin, Hesperitin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Citrus paradisi''-1 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-2 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-3 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-4 (seed)&lt;br /&gt;
# 3 μL ''Citrus paradisi''-5 (seed)&lt;br /&gt;
# 3 μL Naringin, Naringenin ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Method Developed by Alkemists Laboratories&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC, Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=ABC-logo-horiz.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/GrapefruitSeedExtractLabGuidanceDocument.html&lt;br /&gt;
             | description=Grapefruit (seed extract) (''Citrus paradisi'')&lt;br /&gt;
             | characteristics=This [http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html ABC BAPP Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic grapefruit seed extract ingredients and non-authentic materials, with particular discussion of synthetic microbicidal compounds identified in non-authentic materials, authentic grapefruit seed extract components, and a detailed literature review of methods (including sample characterization via TLC, HPLC-UV, HPLC-MS, GC-MS, and others).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Actaea_racemosa_(root_and_rhizome)</id>
		<title>Actaea racemosa (root and rhizome)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Actaea_racemosa_(root_and_rhizome)"/>
				<updated>2018-10-12T18:48:19Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add summary and link to ABC BAPP Lab Guidance for black cohosh */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Actaea racemosa'' (root and rhizome)}}  {{askbox|herb=''Actaea racemosa''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Actaea racemosa&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=black cohosh&lt;br /&gt;
|syn=''Cimicifuga racemosa'' (L.) Nutt.&lt;br /&gt;
|aka=black bugbane; black snakeroot; rheumatism weed&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{media3 |companyimage=TropicosLogo.gif&lt;br /&gt;
 | companyURL=http://www.tropicos.org/Image/100105518&lt;br /&gt;
 |mainimage=Actaea racemosa Tropicos 100105518.jpg&lt;br /&gt;
 |source=Tropicos.org. Missouri Botanical Garden. 05 Aug 2013&lt;br /&gt;
 |cat=Voucher&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
| companyimage2=Kewlogo.gif&lt;br /&gt;
| companyURL2=http://specimens.kew.org/herbarium/K000694465&lt;br /&gt;
| image2=Actaea_racemosa_Kew_imageBarcode=K000694465_306208.jpg&lt;br /&gt;
| source2=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
| companyimage3=Kewlogo.gif&lt;br /&gt;
| companyURL3=http://specimens.kew.org/herbarium/K000694466&lt;br /&gt;
| image3=Actaea_racemosa_Kew_imageBarcode=K000694466_306208.jpg&lt;br /&gt;
| source3=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Rhizome externally dark brown; internally whitish and mealy or dark brown and waxy; odor slight; taste bitter and acrid. &lt;br /&gt;
&lt;br /&gt;
Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown; internally bark dark brown, wood yellowish.  The odor, though not strong, is peculiar and rather disagreeable, and is gradually lost with age.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;... [A] tall stately plant, having a perennial root, and a simple herbaceous stem, which rises from four to eight feet in height. The leaves are large, and ternately decompound, having oblong-ovate leaflets, incised and toothed at their edges. The flowers are small, white, and disposed in a long, terminal, wand-like raceme, with occasionally one or two shorter racemes near its base. The calyx is white, four-leaved, and deciduous; the petals are minute, and shorter than the stamens; the pistil consists of an oval ovary and sessile stigma. The fruit is an ovoid capsule containing numerous flat seeds. &lt;br /&gt;
&lt;br /&gt;
&amp;quot;Rhizome horizontal, more or less branching, from 2 to 12 cm. in length, and from 1 to 2.5 cm. in thickness; externally dark brown, slightly annulate from circular scars of bud scale-leaves, the upper surface with numerous stout, erect or somewhat curved branches terminated by deep, cup-shaped sears, each of which usually shows a distinct radiate structure; inferior and lateral portions with numerous root-scars and a few short roots; fracture horny; internally whitish and mealy or dark brown and waxy, bark thin, wood distinctly radiate and of about the same thickness as the pith... Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown, longitudinally wrinkled; fracture short; internally bark dark brown, wood yellowish, 4 to 6-rayed.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |mainimage=2013 BC Cut and Sifted AHPA.JPG&lt;br /&gt;
 |source=AHPA.org. Raw material sample. (2013)&lt;br /&gt;
 |cat=Macroscopic&lt;br /&gt;
&lt;br /&gt;
|companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
|image2=Alkemists_Actaea_racemosa_macro.jpg&lt;br /&gt;
           |caption2=Root, cut and sifted&lt;br /&gt;
           |source2=Alkemist Laboratories&lt;br /&gt;
&lt;br /&gt;
|companyimage3=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL3=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |image3=2014 BC SE Kentucky AHPA.JPG&lt;br /&gt;
 |source3=AHPA.org. Raw material sample. (2014)}}&lt;br /&gt;
&lt;br /&gt;
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
 | companyURL=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
 |mainimage=2014 BC SE Missouri AHPA.JPG&lt;br /&gt;
 |source=AHPA.org. Raw material sample. (2014)&lt;br /&gt;
 |cat=Macroscopic&lt;br /&gt;
&lt;br /&gt;
| companyimage2=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
| companyURL2=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
| image2=2014 BC Virginia AHPA.JPG&lt;br /&gt;
| source2=AHPA.org. Raw material sample. (2014) &lt;br /&gt;
&lt;br /&gt;
| companyimage3=14 0924 AHPA logo High Res.jpg&lt;br /&gt;
| companyURL3=http://www.ahpa.org/Default.aspx?tabid=84&lt;br /&gt;
| image3=2014 BC W. Virginia AHPA.JPG&lt;br /&gt;
| source3=AHPA.org. Raw material sample. (2014) &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Microscopy| source=United States Dispensatory (1918)&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Under the microscope, sections of the rhizome ... show a yellowish-brown suberized epidermis, a cortex made up of about 30 layers of starch-bearing parenchyma cells; the fibro-vascular bundles collateral, the xylem consisting of tracheae with bordered pores, and resembling tracheids in that the ends are rather acute; wood-fibers numerous, thin-walled, strongly lignified and with simple, oblique pores, the bundles separated by starch-bearing parenchyma strands from 5 to 30 cells wide; pith cells numerous, resembling those of the cortex. &lt;br /&gt;
&lt;br /&gt;
&amp;quot;... sections of the root ... show a hairy epidermis, which becomes suberized in older roots; the cortex shows about 12 rows of starch-bearing parenchyma cells; endodermis distinct; fibro-vascular bundles 4 to 6, showing in older roots as separate collateral bundles. The powder is light to dark brown; starch grains numerous, single or compound, the individual grains spherical or more or less polygonal, each with a somewhat central cleft, from 0.003 to 0.015 mm. in diameter; fragments showing trachea with bordered pores and lignified wood-fibers; irregular, yellowish-brown fragments of suberized epidermis made up of more or less tabular cells, sometimes elongated and considerably thickened.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
{{media |cat=Microscopy&lt;br /&gt;
|companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
|mainimage=Alkemists Actaea racemosa brown suberized cells.png&lt;br /&gt;
            | caption1=Brown suberized cells (400X, Acidified chloral hydrate solution)&lt;br /&gt;
           |source=Elan M. Sudberg, Alkemist Laboratories}}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=AHPA Practical, CAMAG HPTLC&lt;br /&gt;
             | companyimage=Camag_logo.png&lt;br /&gt;
             | companyURL=http://www.camag.com/&lt;br /&gt;
             | mainimage=Camag-blackcohosh-1-d-uv254.png&lt;br /&gt;
             | caption1=Black cohosh HPTLC ID - Developed, UV 254 nm&lt;br /&gt;
             | description=Black cohosh (root) (''Actaea racemosa'')&lt;br /&gt;
             | image2=Camag-blackcohosh-1-d-uv366.png&lt;br /&gt;
             | caption2=Black cohosh HPTLC ID - Developed, UV 366 nm&lt;br /&gt;
             | image3=Camag-blackcohosh-1-H2SO4-uv366.png&lt;br /&gt;
             | caption3=Black cohosh HPTLC ID - Sulfuric acid reagent, UV 366 nm&lt;br /&gt;
             | image4=Camag-blackcohosh-1-H2SO4-whiteRT.png&lt;br /&gt;
             | caption4=Black cohosh HPTLC ID Method - Sulfuric acid reagent, white RT &lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Stationary phase, i.e. Silica gel 60, F254&lt;br /&gt;
             | mobilephase=Toluene, ethyl formate, formic acid 50:30:20 (v/v/v)&lt;br /&gt;
             | prep=Sample: Mix 0.5 g of powdered sample with 10 mL of an ethanolwater&lt;br /&gt;
mixture (1:1) and sonicate for 10 minutes, then&lt;br /&gt;
centrifuge or filter the solutions and use the&lt;br /&gt;
supernatants/filtrates as test solutions.&lt;br /&gt;
&lt;br /&gt;
Sulfuric Acid Reagent: Preparation: 20 mL of sulfuric acid are mixed with 180 mL&lt;br /&gt;
of ice-cooled methanol&lt;br /&gt;
             | detection=UV/Vis, Sulfuric Acid Reagent Use: Dip (time 0, speed 5), heat at 100°C for 5 min&lt;br /&gt;
             | referencesamples=Reference: Dissolve 1mg of actein, 23-epi-26-deoxyactein, isoferulic&lt;br /&gt;
acid, cimifugin and/or norcimifugin individually in 10 mL&lt;br /&gt;
of methanol.&lt;br /&gt;
             |&lt;br /&gt;
             | lanes=Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Isoferulic acid&lt;br /&gt;
# 2 μL Norcimifugin&lt;br /&gt;
# 2 μL Actein&lt;br /&gt;
# 2 μL 23-epi-26-Deoxyactein&lt;br /&gt;
# 2 μL Cimifugin&lt;br /&gt;
# 2 μL ''C. racemosa''&lt;br /&gt;
# 2 μL ''C. racemosa''&lt;br /&gt;
# 2 μL ''C. foetida''&lt;br /&gt;
# 2 μL ''C. heracleifolia''&lt;br /&gt;
# 2 μL ''C. dahurica''&lt;br /&gt;
# 2 μL ''C. americana''&lt;br /&gt;
             | notes=Compare result under UV 254 nm and white RT with reference images in Image Comparison&lt;br /&gt;
Viewer. The fingerprint of the test solution is similar to that of the corresponding botanical reference&lt;br /&gt;
sample. Additional weak zones may be present.&lt;br /&gt;
&lt;br /&gt;
''C. racemosa'' Identification: Under UV 254 nm the chromatogram obtained with the test solution does not&lt;br /&gt;
show a dark zone at the position of Cimifugin in the reference solution or just&lt;br /&gt;
above it.&lt;br /&gt;
Under white RT a characteristic fingerprint is detected. Below Cimifugin there&lt;br /&gt;
are two violet zones. Just above the application position two brown zones are&lt;br /&gt;
detected (blue arrow).&lt;br /&gt;
There is no brown zone at the position of Cimifugin, but there might be a faint&lt;br /&gt;
violet zone. There is a brown zone at the position of actein as well as two&lt;br /&gt;
brown zone just below. Just above the actein zone is a very thin brown zone&lt;br /&gt;
(green arrow).&lt;br /&gt;
&lt;br /&gt;
Further methodology available here, in [http://www.ahpa.org/portals/0/pdfs/Black_cohosh_ID_Method.pdf Identification of black cohosh by HPTLC].&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
[[Category:DNA]]&lt;br /&gt;
{| border=1&lt;br /&gt;
|[[File:NY_Botanical_Garden_logo.png|right|150x75px]]&lt;br /&gt;
'''Black Cohosh (''Actaea racemosa'')'''&lt;br /&gt;
&lt;br /&gt;
'''Amplification primers:''' &lt;br /&gt;
&lt;br /&gt;
NY1400 (5′-CAT TTT CTT GAT TTT CTG GGC TA-3′) and NY1401 (5′-CCG GCT TAC TAA TGG GAT G-3′)&lt;br /&gt;
&lt;br /&gt;
'''PCR reaction mixture:'''&lt;br /&gt;
&lt;br /&gt;
15 µL final volume containing 1.5 µL PCR buffer (200 mM tris [pH 8.8], 100 mM KCl, 100 mM (NH&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;)&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;SO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;, 20 mM MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;, 1% [v/v] Triton X-100, 50% [w/v] sucrose, 0.25% [w/v] cresol red), 0.2 µM dNTPs, 0.025 μg/μL bovine serum albumin (BSA), 1 μM of each primer, 0.25 units of ''Taq'' polymerase, and 0.5 µL template DNA.&lt;br /&gt;
&lt;br /&gt;
'''PCR program:''' 95°C for 2.5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, 72°C for 30 s; 72°C for 10 min. &lt;br /&gt;
&lt;br /&gt;
'''Sequencing primers:''' Same as amplification primers.&lt;br /&gt;
&lt;br /&gt;
'''Sequence:''' &lt;br /&gt;
5′-TCT TTC AAG TGT ACG AAA AAA TCC TTC GGT GGT AAG GAG TCA AAT GTT AGA AAA TTC ATT TAT TAT AGA CAT TGC TAT TAA TAA GTT TGA TAC TAT AGT CCC AAT TAT TCC TTT GAT TGG ATT ATT GGC TAA AGC GAA ATT TTG TAA CTT ATC GGG G-3′&lt;br /&gt;
&lt;br /&gt;
'''Diagnostic positions:'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;               0000011111222222233334444444455566667&lt;br /&gt;
               1567946789023444705590004567900501130&lt;br /&gt;
               2669211792396679602777892010701063662&lt;br /&gt;
A. arizonica   GACAGCCCCCGTATTTCCGCACATTACGCTCACTACG&lt;br /&gt;
A. asiatica    ........T........TA.G...........T....&lt;br /&gt;
A. biternata   ----....T......G..AT............T..TT&lt;br /&gt;
A. cimicifuga  TG......T.........A.....C......GT.G..&lt;br /&gt;
A. cordifolia  .....................................&lt;br /&gt;
A. dahurica    ---.....TT........A....CC..T...GT.G..&lt;br /&gt;
A. elata       .......T..........AT..G.....G........&lt;br /&gt;
A. pachypoda   ........T........TA.............T....&lt;br /&gt;
A. podocarpa   .......T...C......AT......A..........&lt;br /&gt;
A. racemosa    ...M....T........TA..........AA.T....&lt;br /&gt;
A. rubra       -.......T........TA.R...........T....&lt;br /&gt;
A. simplex     TRM.....T.......M.A..M..C.Y.S..GT.G..&lt;br /&gt;
A. spicata     ........T........TA.............TG...&lt;br /&gt;
A. vaginata    ...-AGA.T.A.TGG...A.GA...C.T....T....&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
== ABC Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC, Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=ABC-logo-horiz.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html&lt;br /&gt;
             | description=Black cohosh (root and rhizome) (''Actaea racemosa'')&lt;br /&gt;
             | characteristics=This [http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html ABC BAPP Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic black cohosh ingredients and non-authentic materials, with particular discussion of other species of ''Actaea'' and other plants also known in China as ''sheng ma''-type species, phenolic acid profiles, and a detailed literature review of methods (including sample characterization via HPLC, HPTLC, MS, and NMR).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical | source=AHPA Known Adulterants&lt;br /&gt;
             | description=Black cohosh (root) (''Actaea racemosa'', syn ''Cimicifuga racemosa'')&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Chinese cimicifuga (root) (''Actaea'' spp.).  Also known as ''sheng ma'' or Rhizoma Cimicifugae; consists of ''Actaea cimicifuga'', syn. ''Cimicifuga foetida''; ''Actaea dahurica'', syn. ''C. dahurica''; ''A. heracleifolia'', syn. ''C. heracleifolia''; and possibly other Asian species of ''Actaea''.&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== AHPA Practical: Detecting Adulteration of Black cohosh root/rhizome ==&lt;br /&gt;
[[Category:AHPA Practicals]]&lt;br /&gt;
[[File:AHPA Logo.gif|right|150x75px|link=http://www.ahpa.org/]]&lt;br /&gt;
Reproduced from [http://www.ahpa.org/Default.aspx?tabid=170].&lt;br /&gt;
===Introduction===&lt;br /&gt;
The American Herbal Products Association is providing here analytical tools and methods to identify adulteration of raw materials and dietary ingredients labeled as black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') root/rhizome, or extracts thereof. This information is provided for industry in order to deal appropriately with reports of adulteration of this ingredient and make wise purchasing decisions.&lt;br /&gt;
===Background===&lt;br /&gt;
The economic adulteration of black cohosh root and rhizome with other species is well established. AHPA’s guidance policy on [http://www.ahpa.org/Default.aspx?tabid=223 Known Adulterants] identifies Chinese cimicifuga root/rhizome, also known as ''sheng ma'' or Rhizoma Cimicifugae as known black cohosh adulterants. This material commonly consists of ''Actaea cimicifuga'', syn. ''Cimicifuga foetida''; ''Actaea dahurica'', syn. ''C. dahurica''; ''A. heracleifolia'', syn. ''C. heracleifolia''; and possibly other Asian species of ''Actaea''. The citation below provides a review of Rhizoma Cimicifugae for those wanting additional information.&lt;br /&gt;
&lt;br /&gt;
Li JX, Yu ZY. [http://www.benthamscience.com/cmc/contabs/cmc13-24.htm#7 Cimicifugae rhizoma: from origins, bioactive constituents to clinical outcomes.] ''Curr Med Chem''. 2006;13(24):2927-51.&lt;br /&gt;
&lt;br /&gt;
The black cohosh monograph in the ''Natural Health Ingredients Database'' of the Canadian Natural Health Products Directorate at Health Canada, available online [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/monoReq.do?id=44&amp;amp;lang=eng here] or as a pdf file [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/dbImages/559 here], references instances where adverse events associated with ingestion of products labeled as containing black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') were found to contain plant species that were not black cohosh upon laboratory analysis. The ''Canadian Adverse Reaction Newsletter'' ([http://www.hc-sc.gc.ca/dhp-mps/alt_formats/pdf/medeff/bulletin/carn-bcei_v20n1-eng.pdf 2010 Jan;20(1):1-2]) provided specifics on this situation as covered in a [http://www.ahpa.org/Default.aspx?tabid=69&amp;amp;aId=568&amp;amp;zId=1 January 14, 2010 AHPA Update].&lt;br /&gt;
&lt;br /&gt;
===Analytical tools===&lt;br /&gt;
There are several analytical tools available for the authentication of genuine black cohosh and its differentiation from other species. Two papers detailing the use of high performance thin-layer chromatography (HPTLC) are cited below. The first focuses on detection of black cohosh adulteration by other North American Actaea species while the second deals more specifically with differentiation of black cohosh from Chinese cimicifuga. The full methodology for the HPTLC analysis of the second citation can be accessed via this: [http://www.ahpa.org/portals/0/pdfs/Black_cohosh_ID_Method.pdf Identification of black cohosh by HPTLC].&lt;br /&gt;
&lt;br /&gt;
The third citation below employed phytochemical “fingerprinting” using high-performance liquid chromatography with a photo-diode array detector (HPLC-PDA) and liquid chromatography with mass spectrometry detection (LC-MS) to authenticate black cohosh and differentiate it from 14 other Actaea species.&lt;br /&gt;
====HPTLC Methods====&lt;br /&gt;
Verbitski SM, Gourdin GT, Ikenouye LM, McChesney JD, Hildreth J. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.2.268 Detection of Actaea racemosa adulteration by thin-layer chromatography and combined thin-layer chromatography-bioluminescence.] J AOAC Int. 2008 Mar-Apr;91(2):268-75.&lt;br /&gt;
&lt;br /&gt;
Ankli A, Reich E, Steiner M. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.6.1257 Rapid high-performance thin-layer chromatographic method for detection of 5% adulteration of black cohosh with ''Cimicifuga foetida'', ''C. heracleifolia'', ''C. dahurica'', or ''C. americana''.] J AOAC Int. 2008 Nov-Dec;91(6):1257-64.&lt;br /&gt;
====HPLC Method====&lt;br /&gt;
[[Category:HPLC]]&lt;br /&gt;
Jiang B, Ma C, Motley T, Kronenberg F, Kennelly EJ. [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/abstract Phytochemical fingerprinting to thwart black cohosh adulteration: a 15 ''Actaea'' species analysis.] Phytochem Anal. 2011 Feb 19. doi: 10.1002/pca.1285. [Epub ahead of print] Supporting information is available [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/suppinfo here]. &lt;br /&gt;
&lt;br /&gt;
The black cohosh monograph in the ''Natural Health Ingredients Database'' of the Canadian Natural Health Products Directorate at Health Canada, available online [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/monoReq.do?id=44&amp;amp;lang=eng here] or as a pdf file [http://webprod.hc-sc.gc.ca/nhpid-bdipsn/dbImages/559 here], references instances where adverse events associated with ingestion of products labeled as containing black cohosh (''Actaea racemosa'' syn. ''Cimicifuga racemosa'') were found to contain plant species that were not black cohosh upon laboratory analysis. The ''Canadian Adverse Reaction Newsletter'' ([http://www.hc-sc.gc.ca/dhp-mps/alt_formats/pdf/medeff/bulletin/carn-bcei_v20n1-eng.pdf 2010 Jan;20(1):1-2]) provided specifics on this situation as covered in a [http://www.ahpa.org/Default.aspx?tabid=69&amp;amp;aId=568&amp;amp;zId=1 January 14, 2010 AHPA Update].&lt;br /&gt;
&lt;br /&gt;
The [http://www.herbal-ahp.org/order_online.htm American Herbal Pharmacopoeia] and the [http://www.usp.org/products/dsc/ USP Dietary Supplements Compendium] also contain useful information for the differentiation of black cohosh and other species representing common black cohosh adulterants. Authenticated black cohosh reference materials are available from both organizations as well as AHPA member companies [http://www.alkemist.com/ Alkemists Laboratories], [http://www.botanicalliaisons.com/ Botanical Liaisons], and [http://www.chromadex.com/ Chromadex]. DNA testing can be used to verify authentic species, and rule out the presence of common or other unexpected DNA-containing adulterants or contaminants. Work in this area is currently being conducted by AHPA member [http://www.authentechnologies.com/ AuthenTechnologies].&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
===NMR Barcoding, Qiu, ''et al.'', 2014===&lt;br /&gt;
'''2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes,''' &lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
The interpretation of NMR spectroscopic information for structure elucidation involves decoding of complex resonance patterns that contain valuable molecular information (δ and J), which is not readily accessible otherwise. We introduce a new concept of 2D-NMR barcoding that uses clusters of fingerprint signals and their spatial relationships in the δ−δ coordinate space to facilitate the chemical identification of complex mixtures. Similar to widely used general barcoding technology, the structural information of individual compounds is encoded as a specifics pattern of their C,H correlation signals. Software-based recognition of these patterns enables the structural identification of the compounds and their discrimination in mixtures. Using the triterpenes from various Actaea (syn. Cimicifuga) species as a test case, heteronuclear multiple-bond correlation (HMBC) barcodes were generated on the basis of their structural subtypes from a statistical investigation of their δH and δC data in the literature. These reference barcodes allowed in silico identification of known triterpenes in enriched fractions obtained from an extract of A. racemosa (black cohosh). After dereplication, a differential analysis of heteronuclear single-quantum correlation (HSQC) spectra even allowed for the discovery of a new triterpene. The 2D barcoding concept has potential application in a natural product discovery project, allowing for the rapid dereplication of known compounds and as a tool in the search for structural novelty within compound classes with established barcodes.&amp;lt;ref&amp;gt;&lt;br /&gt;
    Qiu, F., McAlpine, J.B., Lankin, D.C., Burton, I., Karakach, T., Chen, S., Pauli G.F. 2014. 2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes  ''Analytical Chemistry''  86(8), 3964-3972. http://pubs.acs.org/doi/abs/10.1021/ac500188j&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Countercurrent Chromatography, Cicek, ''et al.'', 2010===&lt;br /&gt;
'''Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection.'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
In the present work, a fast and simple method for the separation and purification of triterpene saponins from Actaea racemosa was successfully established. Accelerated solvent extraction was used for defatting and extracting of the subaerial parts, giving a triterpene enriched crude extract. Size exclusion chromatography was used to separate actein and 23-epi-26-deoxyactein from other triterpenoids, which were collected in a third fraction. This most complex third fraction was applied to high-speed countercurrent chromatography, a well-established technique for the separation of saponins. Separation parameters were first optimized on an analytical level, using a hyphenated HSCCC-ELSD setup, before the system was scaled up to preparative size. The resulting two-phase solvent system, consisting of N-hexane-acetone-ethyl acetate-2-propanol-ethanol-water (3.5 : 1 : 2 : 1 : 0.5 : 2, v/v/v/v/v/v), enabled the isolation of 23-O-acetylshengmanol-3-O- beta-D-xylopyranoside (17.4 mg), cimiracemoside D (19.5 mg), 25-O-acetylcimigenol-3-O-beta-D-xylopyranoside (7.1 mg) and the aglycone cimigenol (5.9 mg). Purity of the isolated substances was 96.8 %, 96.2 %, 97.9 %, and 98.4 %, respectively. The same method was suitable for the purification of actein and 23-epi-26-deoxyactein, with purities of 97.0 % and 98.3 %.&amp;lt;ref&amp;gt;&lt;br /&gt;
Cicek, S.S., Schwaiger, S., Ellmerer, E.P., Stuppner, H. 2010. Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection. ''Planta Med.'' 76(5):467-73.  http://www.ncbi.nlm.nih.gov/pubmed/19847744&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===HPLC/MS analysis, Liu, ''et al.'', 2003===&lt;br /&gt;
[[Category:HPLC]]&lt;br /&gt;
'''Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry.'''&lt;br /&gt;
&lt;br /&gt;
&amp;lt;blockquote&amp;gt;'''Abstract.'''&lt;br /&gt;
&lt;br /&gt;
Caffeic acid derivatives occurring in black cohosh [Cimicifuga racemosa (L.) Nutt., Actaea racemosa (Ranunculaceae)], some of which may have pharmacological activity, were analyzed using high-performance liquid chromatography (HPLC) electrospray ionization tandem mass spectrometry (ESI-MS/MS) with the aim of developing a methodology for their rapid identification in a complex plant matrix. Based on these studies, structurally characteristic product ions and neutral molecule losses were identified, which were then used during LC/MS/MS with product ion scanning, precursor scanning and constant neutral loss scanning to detect caffeic acid derivatives in a crude extract of black cohosh. Several caffeic acid derivatives were detected, and the identification of six of them were confirmed by comparison with authentic standards including caffeic acid, ferulic acid, isoferulic acid, fukinolic acid, cimicifugic acid A, and cimicifugic acid B. Four other compounds were detected that appeared to be caffeic acid derivatives based on LC/MS/MS retention times, molecular weights, and fragmentation patterns during MS/MS. Since standards were unavailable for these four compounds, they were tentatively identified using LC/MS/MS as cimicifugic acid E, cimicifugic acid F, dehydrocimicifugic acid A, and dehydrocimicifugic acid B. Dehydrocimicifugic acid A and dehydrocimicifugic acid B have not been reported previously to be constituents of black cohosh.&amp;lt;ref&amp;gt;&lt;br /&gt;
Liu, W., Sun, Y., Liang, W., Fitzloff, J.F., van Breemen, R.B. 2003. Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry. ''Rapid Commun Mass Spectrom.'' 17(9):978-82.  http://www.ncbi.nlm.nih.gov/pubmed/12717772&amp;lt;/ref&amp;gt;&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Vaccinium_myrtillus_(fruit)</id>
		<title>Vaccinium myrtillus (fruit)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Vaccinium_myrtillus_(fruit)"/>
				<updated>2018-10-12T15:28:54Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add summary and link to ABC BAPP Lab Guidance for Bilberry */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Vaccinium myrtillus'' (fruit)}} {{askbox|herb=''Vaccinium myrtillus''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Vaccinium myrtillus&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ericaceae&lt;br /&gt;
|scn=bilberry&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=European blueberry; huckleberry; whortleberry&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{media2 |cat=Voucher&lt;br /&gt;
|companyimage=Starr herbarium logo.png&lt;br /&gt;
| companyURL=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
| companyimage2=Starr herbarium logo.png&lt;br /&gt;
| companyURL2=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
| mainimage=Vaccinium myrtillus L. var. californicum - Starr - 00010601.jpg&lt;br /&gt;
|caption1=''Vaccinium myrtillus'' L. var. ''californicum''&lt;br /&gt;
|source=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
|image2=Vaccinium myrtillus L. var. microphyllum - Starr - 00010602.jpg&lt;br /&gt;
|caption2=''Vaccinium myrtillus'' L. var. ''microphyllum''&lt;br /&gt;
|source2=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Macroscopy &lt;br /&gt;
| source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 619.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
             | &lt;br /&gt;
| source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile_-_2538.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Microscopy | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | description=Cellular structures identified in this botanical specimen are the group of thick walled stone cells from the inner fruit wall and the large oil droplets when observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
{{Media2 |cat=Microscopy |companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL= http://www.alkemist.com&lt;br /&gt;
 |companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2= http://www.alkemist.com&lt;br /&gt;
|mainimage= Bilberry berry whole.jpg&lt;br /&gt;
           |caption1= Group of thick walled stone cells from the inner fruit wall observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source= Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
|image2= Bilberry berry whole-1.jpg&lt;br /&gt;
           |caption2= Large oil droplets observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source2= Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=HPTLC Association&lt;br /&gt;
             | companyimage=HPTLC-assoc-Logo-farbig-Text-schwarz-300x47.png&lt;br /&gt;
             | companyURL=http://www.hptlc-association.org/&lt;br /&gt;
             | mainimage=Vaccinium myrtillus-hptlc-association.png&lt;br /&gt;
             | caption1=''Vaccinium myrtillus'' (fruit) HPTLC ID -  Developed, white RT&lt;br /&gt;
             | description=Bilberry (fruit) (''Vaccinium myrtillus'')&lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Stationary phase, i.e. Silica gel 60, F254&lt;br /&gt;
             | mobilephase=1-Butanol, formic acid, water 65:16:19 (v/v/v)&lt;br /&gt;
             | prep=Sample: Mix 1 g of powdered sample with 10 mL of methanol and sonicate for 10 minutes, then centrifuge or filter the solutions and use the supernatants / filtrates as test solutions.&lt;br /&gt;
&lt;br /&gt;
Derivatization reagent: no derivatization &lt;br /&gt;
             | detection=Saturated chamber; developing distance 70 mm from lower edge; relative humidity 33%&lt;br /&gt;
             | referencesamples=Reference: Dissolve 2 mg of pelargonin in 5 mL of methanol. Dissolve 2 mg of delphinidin in 5 mL of methanol. Optional: dissolve 2 mg of malvidin in 5 mL of methanol. &lt;br /&gt;
             |&lt;br /&gt;
             | lanes=Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 3 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 4 µL	Bilberry fruit (Ph.Eur. extraction)&lt;br /&gt;
# 2 µL	Bilberry fruit&lt;br /&gt;
# '''3 µL	Bilberry fruit'''&lt;br /&gt;
# 4 µL	Bilberry fruit&lt;br /&gt;
# 2 µL	Pelargonin&lt;br /&gt;
# 2 µL	Malvidin&lt;br /&gt;
# 2 µL	Delphinidin&lt;br /&gt;
# 2 µL	Mallow flower&lt;br /&gt;
# 4 µL	Mallow flower&lt;br /&gt;
# 6 µL	Mallow flower&lt;br /&gt;
# 2 µL	Roselle flower&lt;br /&gt;
# 4 µL	Roselle flower&lt;br /&gt;
# 6 µL	Roselle flower&lt;br /&gt;
 &lt;br /&gt;
             | notes=''Images presented in this entry are examples and are not intended to be used as basis for setting specifications for quality control purposes.''&lt;br /&gt;
System suitability test: Pelargonin: red to orange zone at Rf ~ 0.89; Delphinidin: violet zone at Rf ~ 0.80&lt;br /&gt;
&lt;br /&gt;
Identification: Compare result with reference images. The fingerprint of the test solution is similar to that of the corresponding botanical reference sample. Additional weak zones may be present. The chromatogram of the test solution shows four violet to violet-blue zones between Rf ~ 0.46 and 0.58.&lt;br /&gt;
&lt;br /&gt;
Test for adulteration: No intense violet zone is seen at Rf ~ 0.35 (Mallow flower). There is neither a blue zone at Rf ~ 0.37 nor a violet zone at Rf ~ 0.44 (Roselle flower).&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
== ABC Botanical Adulterants Prevention Program Laboratory Guidance ==&lt;br /&gt;
{{Botanical  | source=ABC, Botanical Adulterants Prevention Program&lt;br /&gt;
           | companyimage=ABC-logo-horiz.jpg&lt;br /&gt;
           | companyURL=http://cms.herbalgram.org/BAP/LGD/BilberryLabGuidanceDocument.html&lt;br /&gt;
             | description=Bilberry (fruit extract) (''Vaccinium myrtillus'')&lt;br /&gt;
             | characteristics=This [http://cms.herbalgram.org/BAP/LGD/BilberryLabGuidanceDocument.html ABC BAPP Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic bilberry extracts and non-authentic materials, with particular discussion of known chemical markers of other anthocyanin-rich fruit extracts, synthetic dyes, and a detailed literature review (including HPLC and HPTLC characterization methods).&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Known Adulterants List ==&lt;br /&gt;
{{Botanical  | source=AHPA Known Adulterants&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | description=Bilberry (fruit extract) (''Vaccinium myrtillus'')&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Red dye #2 (amaranth dye)&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Practical: Detecting Artificial Dye Adulteration in &amp;quot;Bilberry&amp;quot; Extracts ==&lt;br /&gt;
[[Category:AHPA Practicals]]&lt;br /&gt;
[[File:AHPA Logo.gif|right|150x75px|link=http://www.ahpa.org/]]&lt;br /&gt;
=== Introduction ===&lt;br /&gt;
The American Herbal Products Association is providing here analytical tools and methods to identify adulteration of powdered raw materials labeled as bilberry (''Vaccinium myrtillus'') extract. There are well-established scientifically valid methods for determining the presence of red dye in materials purported to be powdered bilberry extracts. They are provided now as immediately available practical tools for industry in order to deal appropriately with reports of adulteration of this ingredient and make wise purchasing decisions.&lt;br /&gt;
=== &amp;quot;Bilberry&amp;quot; Extracts Adulterated with Artificial Dyes ===&lt;br /&gt;
In the process of evaluating commercial material labeled as bilberry extract, AHPA member company MediHerb investigated a sample that appeared to meet the listed specification for anthocyanin content by simple spectrometry. However upon further analysis it was discovered that this material was not likely derived from bilberry and was in fact adulterated with amaranth dye (red dye no. 2). Their work has since been published (see: Bilberry adulteration using the food dye amaranth. Penman KG, Halstead CW, Matthias A, De Voss JJ, Stuthe JM, Bone KM, Lehmann RP. [http://pubs.acs.org/cgi-bin/abstract.cgi/jafcau/2006/54/i19/abs/jf061387d.html J Agric Food Chem. 2006 Sep 20;54(19):7378-82]).&lt;br /&gt;
&lt;br /&gt;
Subsequent to the work by Penman et al., Steven Dentali, PhD, AHPA’s vice president of scientific and technical affairs, authored an article published in the trade journal Nutraceuticals World, which can be accessed [http://www.ahpa.org/portals/0/IA/Bilberry/07_0700_BilberryAdulteration_NutraWorld.pdf here]. This article warns that lower price material available from nontraditional sources can be an initial indication of an adulterated extract. This is especially problematic where common methods of analysis are easily “cheated” so that a specification is met, but the material is not what it should be. &lt;br /&gt;
&lt;br /&gt;
The information presented here is intended to educate industry about the potential quality problem with ingredients labeled as bilberry extract and to provide a scientifically valid method to aid in the differentiation between genuine bilberry fruit extract and material adulterated with amaranth dye. When examined with these methods by qualified individuals, information should be obtained that will allow more informed purchasing decisions than may be available with single wavelength spectroscopic analysis.  &lt;br /&gt;
=== Methods for Detection of Dye in &amp;quot;Bilberry&amp;quot; Extracts ===&lt;br /&gt;
==== Anthocyanins turn blue at elevated pH ====&lt;br /&gt;
Bilberry extracts are blue-black in color but form a pink solution when diluted at neutral pH. At elevated pH, anthocyanins change color and anthocyanin-containing solutions, such as can be made by diluting bilberry extract with water, turn blue. This is illustrated [http://www.ahpa.org/portals/0/IA/Bilberry/VM001.pdf here] where the far left solution is very dilute true bilberry extract, next is this solution with the pH adjusted to greater than 10, next is dilute fake bilberry extract under the same conditions, and lastly very dilute fake bilberry extract. &lt;br /&gt;
&lt;br /&gt;
This experiment is simple to replicate with bilberry extract or any other anthocyanin-containing materials and so is not necessarily indicative of bilberry anthocyanins. In fact this principle is easily observable by adding baking soda to dilute anthocyanin containing solutions.  A “kitchen test” using diluted red wine, or grape juice, or other suitable (anthocyanin-containing) juice can be performed to illustrate this property of anthocyanins. Sprinkling baking soda into such a prepared dilute reddish solution will cause it to turn purple or bluish. This same color transformation will happen with bilberry (or other anthocyanin containing) extract, but does not occur with amaranth dye.&lt;br /&gt;
&lt;br /&gt;
==== High performance thin layer chromatography (HPTLC) ====&lt;br /&gt;
Authentic bilberry can be easily differentiated from materials adulterated with amaranth dye under the HPTLC conditions used to create the image shown [http://www.ahpa.org/portals/0/IA/Bilberry/VM002.pdf here]. Lanes 1 and 4 are authentic bilberry extract. The horizontal colored bands represent anthocyanin compounds. The adulterated samples in lanes 2 and 3 have a different pattern of colored bands and, most notably, a bright red band that corresponds to amaranth dye. The last lane shows what pure amaranth dye looks under these same conditions. &lt;br /&gt;
&lt;br /&gt;
Click [http://www.ahpa.org/portals/0/IA/Bilberry/VM003.pdf here] for the HPTLC conditions used to produce this result.&lt;br /&gt;
&lt;br /&gt;
=== Other Relevant Sources of Bilberry Information ===&lt;br /&gt;
==== AHP and USP monographs ====&lt;br /&gt;
The American Herbal Pharmacopoeia and Therapeutic Compendium has published a bilberry fruit monograph that includes standards of analysis, quality control, and therapeutic information. More information can be found at [http://www.herbal-ahp.org/titles.htm].&lt;br /&gt;
&lt;br /&gt;
The United States Pharmacopeia has published a dietary supplement monograph for powdered bilberry extract as an in-process revision in the Pharmacopeial Forum, July–Aug. 2007;33(4):685-688.&lt;br /&gt;
&lt;br /&gt;
==== Other compositional analysis and quantification of bilberry anthocyanins ====&lt;br /&gt;
&lt;br /&gt;
The Journal of Agricultural and Food Chemistry has published a method of anthocyanin analysis in bilberry. That abstract can be accessed [http://pubs.acs.org/cgi-bin/abstract.cgi/jafcau/2004/52/i04/abs/jf034596w.html here]. &lt;br /&gt;
&lt;br /&gt;
A more recent paper published by the Journal of AOAC INTERNATIONAL “was developed and validated for the identification and quantification of both anthocyanins and anthocyanidins present in bilberry extracts and products.” The abstract for it is available [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.90.4.911 here].&lt;br /&gt;
&lt;br /&gt;
NUTRAfoods published a review of ten commercial bilberry extracts using USP/NF Pharmacopeial methods of analysis for anthocyanin content. Deficiences were noted in labeling and content of many products. That article can be accessed [http://www.ahpa.org/portals/0/pdfs/07_1000_Artaria_bilberry_extract_comparisons_Nutrafoods.pdf here].&lt;br /&gt;
&lt;br /&gt;
=== Acknowledgements ===&lt;br /&gt;
&lt;br /&gt;
AHPA appreciates the contributions of member companies MediHerb for the technical work and CAMAG Scientific Inc. for the HPTLC method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;br /&gt;
[[Category:Botanical]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:ABC-logo-horiz.jpg</id>
		<title>File:ABC-logo-horiz.jpg</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:ABC-logo-horiz.jpg"/>
				<updated>2018-10-12T14:28:46Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants.  ABC is an independent, nonprofit research and education org...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The American Botanical Council, also known as the Herbal Medicine Institute, is passionate about helping people live healthier lives through the responsible use of herbs and medicinal plants.  ABC is an independent, nonprofit research and education organization dedicated to providing accurate and reliable information for consumers, healthcare practitioners, researchers, educators, industry and the media. education using science-based and traditional information to promote responsible use of herbal medicine — serving the public, researchers, educators, healthcare professionals, industry and media.&lt;br /&gt;
&lt;br /&gt;
From its headquarters at the Case Mill Homestead in Austin, Texas, ABC publishes HerbalGram, a peer-reviewed quarterly journal; HerbClip, a twice-monthly series of summaries and critical reviews of recently published herbal literature; HerbalEGram, a monthly electronic publication; Herbal News &amp;amp; Events, a weekly update on events and media; and the Botanical Monitor, a quarterly newsletter addressing botanical adulteration issues. ABC is also the publisher of four books, including The ABC Clinical Guide to Herbs, a continuing education and reference book, which contains extensive monographs on the safety and efficacy of 30 popular herbs.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Elettaria_cardamomum_(fruit)</id>
		<title>Elettaria cardamomum (fruit)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Elettaria_cardamomum_(fruit)"/>
				<updated>2018-10-12T14:23:00Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* correct mountain rose herbs URL */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Elettaria cardamomum'' (fruit) }} {{askbox|herb=''Elettaria cardamomum''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
{{nomenclature | binomial=Elettaria cardamomum&lt;br /&gt;
|authority=(L.) Maton var. cardamomum&lt;br /&gt;
|family=Zingiberaceae&lt;br /&gt;
|scn=cardamom&lt;br /&gt;
|syn=''Amomum cardamomum'' L.; ''Elettaria cardamomum'' L. var. miniscula Burkill; ''Elettaria cardamomum'' L. var. minus Watt&lt;br /&gt;
|ayurvedic=ela&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Mysore cardamom&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media | cat=Voucher&lt;br /&gt;
| companyimage=Kewlogo.gif&lt;br /&gt;
| companyURL=http://specimens.kew.org/herbarium/K000815813&lt;br /&gt;
| mainimage=Elettaria_cardamomum_Kew_imageBarcode=K000815813_428481.jpg&lt;br /&gt;
| source=Royal Botanic Gardens, Kew. &lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Organolepsy | source=Steven Yeager, Mountain Rose Herbs&lt;br /&gt;
             | companyimage=Mrh logo.jpg&lt;br /&gt;
             | companyURL=http://www.mountainroseherbs.com&lt;br /&gt;
             | description=Cardamom (fruit) (''Elettaria cardamomum'')    &lt;br /&gt;
            | flavor=Aromatic, pungent.&lt;br /&gt;
            | aroma=Aromatic when crushed.}}&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Schneider, A. (1921) The Microanalysis of Powdered Vegetable Drugs, 2nd ed.&lt;br /&gt;
            | description=Cardamom (fruit) (''Elettaria cardamomum'' W. et. M., Scitaminaceae)&lt;br /&gt;
            | color=Light brown.&lt;br /&gt;
            | flavor=Pungent, cooling sensation.&lt;br /&gt;
            | scent=Aromatic, spicy, somewhat camphoraceous. }}&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''Elettaria cardamomum'' ... odor aromatic; taste aromatic, pungent. [...]&lt;br /&gt;
Aromatic odor; taste agreeably warm and aromatic.}}&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''Elettaria cardamomum''&lt;br /&gt;
&lt;br /&gt;
The cardamom plant has a tuberous horizontal rhizome, sending up from eight to twenty erect, simple, smooth, green and shining, perennial stems, which rise from six to twelve feet in height, and bear alternate elliptical-lanceolate sheathing leaves. The flower-stalk proceeds from the base of the stem, and lies upon the ground, with the flowers arranged in a panicle. The fruit is a three-celled capsule, containing many seeds; during drying it is said to lose three-fourths of its weight.&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Mostly agglutinated in groups of from 2 to 7, the individual seeds, oblong-ovoid in outline, 3- or irregularly 4-sided, convex on the dorsal surface, strongly longitudinally grooved on one side, from 3 to 4 mm. in length; externally reddish-gray-brown, coarsely tuberculated, and with more or less adhering portions of the membranous aril; in section showing a thin reddish-brown seed-coat, a large white perisperm and a central, greenish endosperm enclosing a small straight embryo. [...]&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Fruits from one to two centimetres long, ovoid or oblong, bluntly triangular in section, shortly beaked at the apex, pale buff in color, plump and nearly smooth or with slight longitudinal striations. Seeds dark reddish-brown, about three millimetres in length and the same in&lt;br /&gt;
breadth and thickness, irregularly angular, transversely wrinkled, and enclosed in a thin, colorless, membranous aril.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{Media |cat=Macroscopy | source=Steven Yeager, Mountain Rose Herbs&lt;br /&gt;
             | companyimage=Mrh logo.jpg&lt;br /&gt;
             | companyURL=http://www.MountainRoseHerbs.com&lt;br /&gt;
             | description=Cardamom (fruit) (''Elettaria cardamomum'')&lt;br /&gt;
             | mainimage=Elettaria_cardamomum_Fruits_2.JPG&lt;br /&gt;
             | caption1=Cardamom Whole Fruit &lt;br /&gt;
            | characteristics=Fruit a capsule, light to medium green, elliptical, triangular, striated. Seeds oblong-ovoid, irregularly angular, rugose, brown to dark brown adhering to a colorless membranous aril.             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=[''Elettaria cardamomum''] powder is greenish-brown; consisting chiefly of coarse angular fragments of cells of the reserve layers and seed-coat; cells of endosperm and perisperm filled with compound starch grains, the individual grains from 0.001 to 0.004 mm. in diameter; fragments of seed with dark brown stone cells, which are polygonal in surface view and about 0.02 mm. in diameter; in mounts made with hydrated chloral T.S. single prisms or crystals in rosette aggregates may separate in the cells of the endosperm and perisperm; fragments of spiral tracheae with accompanying slightly lignified bast-fibers relatively few. [...] The powdered seeds exhibit abundant, minute, angular starch grains, often compacted into masses; but no spiral vessels, sclerenchymatous fibres, or strongly elongated selerenehymatous cells (absence of pericarps).}}&lt;br /&gt;
&lt;br /&gt;
{{Microscopy | source=Schneider, A. (1921) The Microanalysis of Powdered Vegetable Drugs, 2nd ed.&lt;br /&gt;
            | description=Cardamom (fruit) (''Elettaria cardamomum'' W. et. M., Scitaminaceae)&lt;br /&gt;
            | characteristics=Epidermal cells of pericarp of polygonal cells; parenchyma cells of pericarp thin walled containing prismatic crystals of calcium oxalate; endosperm cells containing oil, minute starch granules and proteid granules.&lt;br /&gt;
Ceylon cardamom is distinguished from the Malabar cardamom by the presence in the former of thick walled, conical, simple trichromes.&lt;br /&gt;
            | ash=Ash 7 per cent.&lt;br /&gt;
            | adulterants=Adulterated with related species and varieties, with orange and lemon seeds.&lt;br /&gt;
            | }}&lt;br /&gt;
&lt;br /&gt;
{{Media3 |cat=Microscopy | source=Amy Brush, Traditional Medicinals&lt;br /&gt;
             | companyimage=TMLogoK832X75.jpg&lt;br /&gt;
             | companyURL=http://www.traditionalmedicinals.com&lt;br /&gt;
             | description=Cardamom (seed) (''Elettaria cardamomum'')&lt;br /&gt;
             | mainimage=Cardamom_seed_coat,_200X.jpg&lt;br /&gt;
             | caption1=Cardamom seed coat, 200x in glycerin:dionized water&lt;br /&gt;
 | source2=Amy Brush, Traditional Medicinals&lt;br /&gt;
             | companyimage2=TMLogoK832X75.jpg&lt;br /&gt;
             | companyURL2=http://www.traditionalmedicinals.com&lt;br /&gt;
             | image2=Cardamom_seed_coat_II,_200x.jpg&lt;br /&gt;
             | caption2=Cardamom seed coat II, 200x in glycerin:dionized water&lt;br /&gt;
 | source3=Amy Brush, Traditional Medicinals&lt;br /&gt;
             | companyimage3=TMLogoK832X75.jpg&lt;br /&gt;
             | companyURL3=http://www.traditionalmedicinals.com&lt;br /&gt;
             | image3=Cardamom_ca_oxalate_in_perisperm,_200x.jpg&lt;br /&gt;
             | caption3=Cardamom ca oxalate in perisperm, 200x in glycerin:dionized water&lt;br /&gt;
             | characteristics=Epidermal cells of pericarp, thin-walled; prismatic crystals of calcium oxalate.&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Cardamom (seed) (''Elettaria cardamomum'' L. Maton)&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Elettaria_cardamomum_-_Alkemists_Laboratories.jpg&lt;br /&gt;
             | caption1=''Elettaria cardamomum'' L. Maton (seeds) HPTLC UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=toluene: ethyl acetate [9.5/0.5]&lt;br /&gt;
             | prep=0.5g+5ml dichloromethane, sonicate/centrifuge/decant, evaporate to dryness with N2, qs with 1.0 ml Toluene&lt;br /&gt;
             | detection=Vanillin/H2SO4 Reagent -&amp;gt; 110° C 5 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes=Lane 1 (1 μl) Linalool ~0.1% in methanol; Lane 2 (2 μl) ''Elettaria cardamomum'' L. Maton-1 (seed)(Guatemala); Lane 3 (2 μl) ''Elettaria cardamomum'' L. Maton-2 (seed)(Guatemala); Lane 4 (2 μl) ''Elettaria cardamomum'' L. Maton-3 (seed), Lane 5 (2 μl) ''Elettaria cardamomum'' L. Maton-3 (seed); Lane 6 (2 μl) ''Elettaria cardamomum'' L. Maton-4  (seed), Lane 7 (1 μl) ''Elettaria cardamomum'' L. Maton-4 (seed; Lane 8 (3 μl) Eugenol~0.1% in methanol, these references have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference sources cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
             | reference=Medicinal Spices, Teuscher, E., 2006, CRC Press or The Ayurvedic Pharmacopoeia of India Part I Volume I&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Stellaria_media_(leaf)</id>
		<title>Stellaria media (leaf)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Stellaria_media_(leaf)"/>
				<updated>2018-05-09T17:03:25Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Microscopy caption correction per 5/9/2018 correspondence&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Stellaria media'' (leaf) }} {{askbox|herb=''Stellaria media''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
{{nomenclature | binomial=Stellaria media&lt;br /&gt;
|authority=(L.) Vill.&lt;br /&gt;
|family=Caryophyllaceae&lt;br /&gt;
|scn=chickweed&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media      | cat=Voucher &lt;br /&gt;
&lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Stellaria_media_Tropicos_100002703_(S).jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100002703&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100002703&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Microscopy | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
       | companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
       | companyURL=http://www.alkemist.com&lt;br /&gt;
       | mainimage=Chickweed herb Alkemist Laboratories.jpg&lt;br /&gt;
| source2=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
       | companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
       | companyURL2=http://www.alkemist.com&lt;br /&gt;
       | caption1=Large cluster of calcium oxalate  observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
&lt;br /&gt;
       | image2=Chickweed herb-1 Alkemist Laboratories.jpg&lt;br /&gt;
       | caption2=Sinuous anticlinal pigmented cell walls observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
       | characteristics=cellular structures identified in this botanical specimen are sinuous anticlinal pigmented cell walls and the large cluster of calcium oxalate when observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | reference=British Herbal Pharmacopoeia, 1983&lt;br /&gt;
       | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Chickweed (leaf) (''Stellaria media'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Stellaria_media_-_Alkemists_Laboratories.jpg&lt;br /&gt;
             | caption1=''Stellaria media'' HPTLC ID - Natural Product Reagent + PEG -&amp;gt; UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=ethyl acetate: formic acid: acetic acid: water [10/1/1/2]&lt;br /&gt;
             | prep=0.3g+3mL 70% grain EtOH sonicate/heat @ 50° C ~ 1/2 hr&lt;br /&gt;
             | detection=Natural Product Reagent + PEG -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Caffeic acid, Chlorogenic Acid, Hyperoside, Rutin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Stellaria media''-1&lt;br /&gt;
# 3 μL ''Stellaria media''-2&lt;br /&gt;
# 3 μL ''Stellaria media''-3&lt;br /&gt;
# 3 μL ''Stellaria media''-3&lt;br /&gt;
# 3 μL ''Stellaria media''-4&lt;br /&gt;
# 3 μL ''Stellaria media''-5&lt;br /&gt;
# 3 μL ''Stellaria media''-6&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Pharmaceuticals, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Plant Drug Analysis, Wagner, H., 1996&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Origanum_vulgare_(leaf_and_flower)</id>
		<title>Origanum vulgare (leaf and flower)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Origanum_vulgare_(leaf_and_flower)"/>
				<updated>2018-05-04T13:09:49Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* microscopic features removed pending revision (see April 26, 2018 correspondence) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Origanum vulgare'' ssp. ''hirtum'' (leaf and flower) }}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
&lt;br /&gt;
| companyimage=Kewlogo.gif&lt;br /&gt;
| companyURL=http://specimens.kew.org/herbarium/K001070104&lt;br /&gt;
| mainimage=Origanum vulgare subsp. hirtum Kew barcode=K001070104 617713.jpg&lt;br /&gt;
| caption=''Origanum vulgare'' subsp. ''hirtum''&lt;br /&gt;
| source=Royal Botanic Gardens, Kew. &lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Organolepsy | source=Culbreth, D. (1917) A Manual of Materia Media and Pharmacology, 6th ed. &lt;br /&gt;
            | description=Aromatic, pungent, bitter.}}&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Culbreth, D. (1917) A Manual of Materia Media and Pharmacology, 6th ed. &lt;br /&gt;
| description=Perennial herb, 0.3-0.5 M. (12-18') high; stem square, purplish, downy; leaves 2.5 Cm. (1') long, ovate, entire, pellucid-punctate, hairy beneath, flowers pale purple, calyx 5-toothed, corolla 2-lipped, 4 exserted didynanamous stamens.&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Illicium_verum_(fruit)</id>
		<title>Illicium verum (fruit)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Illicium_verum_(fruit)"/>
				<updated>2017-11-08T14:14:30Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: adjust Planta Med. link to use DOI system&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Illicium verum'' (fruit) }} {{askbox|herb=''Illicium verum''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
{{nomenclature | binomial=Illicium verum&lt;br /&gt;
|authority=Hook. f.&lt;br /&gt;
|family=Illiciaceae&lt;br /&gt;
|scn=star anise&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=takkola&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{media2 |cat=voucher&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
| source=Royal Botanic Gardens, Kew.&lt;br /&gt;
| companyimage=Kewlogo.gif&lt;br /&gt;
| companyURL=http://specimens.kew.org/herbarium/K000681651&lt;br /&gt;
| mainimage=Illicium_verum_Kew_imageBarcode%3DK000681651_315393.jpg&lt;br /&gt;
&lt;br /&gt;
|companyimage2=Starr herbarium logo.png&lt;br /&gt;
| companyURL2=http://sciweb.nybg.org/science2/VirtualHerbarium.asp&lt;br /&gt;
|image2=Illicium verum Hook.f. - Starr - v-113.7-00205479-01.jpg&lt;br /&gt;
|caption2=''Illicium verum'' Hook.f.&lt;br /&gt;
|source2=Images courtesy of the C.V. Starr Virtual Herbarium of the New York Botanical Garden&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=[''Illicium verum'' ...] odor and taste is aromatic, resembling anise, and this serves to distinguish them from the fruits of the Japanese star-anise ...}}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=[''Illicium verum'' ...] fruit consists of usually 8 boat-shaped follicles or carpels arranged around a central axis. The carpels have an acute summit and taper to a nearly straight beak; externally, they are reddish-brown and somewhat wrinkled; the inner surface is smooth and shiny and encloses a single smooth seed.}}&lt;br /&gt;
&lt;br /&gt;
{{Media |cat=Macroscopy | source=AHPA Practicals, Alkemist Labs&lt;br /&gt;
            | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
            | companyURL=http://www.alkemist.com&lt;br /&gt;
            | mainimage=Alkemist-illicium-verum-1-macro.png&lt;br /&gt;
            | description=Star anise (fruit) (''Illicium verum'')&lt;br /&gt;
            | caption1=Brown/orange fragments of composite ''I. verum'' fruits with long slender follicles&lt;br /&gt;
            | color=Brown/orange.&lt;br /&gt;
            | characteristics=This sample is representative of ''Illicium verum'' fruit based on authenticated reference samples.&lt;br /&gt;
            | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Microscopy | source=AHPA Practicals, Alkemist Labs&lt;br /&gt;
            | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
            | companyURL=http://www.alkemist.com&lt;br /&gt;
            | mainimage=Illicium_verum_-_Alkemist_Laboratories.jpg&lt;br /&gt;
            | description=Star anise (fruit) (''Illicium verum'')&lt;br /&gt;
            | caption1=(1) Large astrosclereid of ''I. verum'' at 400x in acidified chloral hydrate glycerol solution&lt;br /&gt;
| source2=AHPA Practicals, Alkemist Labs&lt;br /&gt;
            | companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
            | companyURL2=http://www.alkemist.com&lt;br /&gt;
            | image2=Illicium_verum-1_-_Alkemist_Laboratories.jpg&lt;br /&gt;
            | caption2=(2) Rhomboidal or rectangular crystals of calcium oxalate of ''I. verum'' at 400x in acidified chloral hydrate glycerol solution&lt;br /&gt;
            | color=Brown/orange.&lt;br /&gt;
            | characteristics=This sample is representative of ''Illicium verum'' fruit based on authenticated reference samples and the consistent characteristic cellular structure of a fruit. The characteristic cellular structures identified in this botanical specimens are the large astrosclereid seen in micrograph (1). In micrograph (2) we see the rhomboidal or rectangular crystals of calcium oxalate. &lt;br /&gt;
&lt;br /&gt;
NOTE: Significant differences found between I. verum and I. anisatum are the macroscopic variations as well as the lack of large astrosclereids in ''I. anisatum''.&lt;br /&gt;
             | reference=British Pharmacopoeia, 2003&lt;br /&gt;
            | }}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
{{HPTLC | source=AHPA Practicals, Alkemist Labs&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Alkemist-star-anise-HPTLC-1-uv365.png&lt;br /&gt;
             | caption1=Star Anise HPTLC Natural Product Reagent + PEG, UV 365 nm&lt;br /&gt;
             | description=Star Anise (fruit) (''Illicium verum'')&lt;br /&gt;
             | image2=Alkemist-star-anise-HPTLC-1-uv254.png&lt;br /&gt;
             | caption2=Star Anise HPTLC, UV light at 254 nm&lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 20 x 10 cm HPTLC plates, Merck or equivalent&lt;br /&gt;
             | mobilephase=Ethyl acetate: glacial acetic acid: formic acid: water [10/1.1/1.1/2.4]&lt;br /&gt;
             | prep=0.5 g raw material with 5 mL CH3OH added and sonicated for 15 minutes then heated in a&lt;br /&gt;
dry block incubator at 65° C for about 1 hr. The supernatant is used as the test solution.&lt;br /&gt;
             | detection=(1) Natural Product Reagent + PEG,  UV 365 nm&lt;br /&gt;
(2) UV light at 254 nm&lt;br /&gt;
             | referencesamples=Lanes 1 and 14, a 1μL of a solution of rutin (AE038, Spectrum), chlorogenic acid (03450-001), hyperoside (072605, Chromadex), and caffeic acid (NG0541, Spectrum), ~0.1% in CH3OH&lt;br /&gt;
             | lanes=Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# Rutin, chlorogenic acid, hyperoside, and caffeic acid standard ~0.1% in CH3OH (1 μL)&lt;br /&gt;
# ''I. anisatum'' fruit (3 μL) voucher specimen&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. anisatum'' fruit (3 μL) voucher specimen&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. verum'' fruit (3 μL)&lt;br /&gt;
# ''I. anisatum'' fruit (3 μL) voucher specimen&lt;br /&gt;
# Rutin, chlorogenic acid, hyperoside, caffeic acid standard (1 μL)&lt;br /&gt;
&lt;br /&gt;
             | notes=The solid yellow lines 10mm from the bottom of the place mark the sample origin. The red line marks the solvent front at&lt;br /&gt;
70mm. Lanes 2, 7, and 13 in the above chromatograms are from ''Illicium anisatum'' voucher specimens while lanes 3, 4, 5, 6,&lt;br /&gt;
8, 9, 10, 11 &amp;amp; 12 were made with ''Illicium verum''. Lanes 1 and 14 are the above described reference materials.&lt;br /&gt;
These chromatograms demonstrate a clear difference between authentic star anise (''I. verum'') fruit and a known adulterant,&lt;br /&gt;
''I. anisatum'' by the following features. The samples in lanes 2, 7, and 13 created from I. anisatum, reveal a distinctly different&lt;br /&gt;
‘fingerprint’ from that of ''I. verum'' in lanes 3 – 5, and 8 – 12. There are no bands or only very light bands between the yellow&lt;br /&gt;
band at Rf ~ 0.50 corresponding to rutin and the bright blue fluorescent band at Rf ~ 0.95 corresponding to caffeic acid in&lt;br /&gt;
the ''I. anisatum'' in image 2 above. There also appears to be no green band in any of the ''I. anisatum'' as is in the ''I. verum''.&lt;br /&gt;
&lt;br /&gt;
These chromatograms clearly reveal the chromatographic differences between (Chinese) star anise (''I. verum'') and its&lt;br /&gt;
adulterant, Japanese star anise (''I. anisatum''), and the ease with which they may be distinguished by High Performance Thin-Layer Chromatography (HPTLC).&lt;br /&gt;
&lt;br /&gt;
Samples in Lanes 2, 3, 4, and 5 were obtained from the American Herbal Pharmacopoeia®, Scotts Valley, CA. Alkemist Pharmaceuticals retains samples of each of these in their herbarium.&lt;br /&gt;
&lt;br /&gt;
Further methodology available here, in [http://ahpa.org/Portals/0/pdfs/12_0119_Star%20Anise%20HPTLC%20Authentication%20rev.pdf Identification method of Star Anise by HPTLC].&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
{{Botanical  | source=AHPA Known Adulterants&lt;br /&gt;
           | companyimage=AHPA Logo.gif&lt;br /&gt;
           | companyURL=http://www.ahpa.org/&lt;br /&gt;
             | description=(Chinese) star anise (fruit) (''Illicium verum'')&lt;br /&gt;
             | characteristics=AHPA recommends in its [http://www.ahpa.org/Default.aspx?tabid=223#section_known_adulterants Known Adulterants list] that appropriate steps be taken to assure that this raw material is free of the noted adulterant.  [mailto:ahpa@ahpa.org Contact AHPA] for additional information regarding relevant analytical methods or follow [http://www.ahpa.org/Default.aspx?tabid=242 this link] for more information.&lt;br /&gt;
             | adulterants=Japanese star anise (''Illicium anisatum'') fruit.&lt;br /&gt;
               }}&lt;br /&gt;
&lt;br /&gt;
== AHPA Practical: Analytical Tools and Methods to Authenticate Star anise (fruit) ==&lt;br /&gt;
[[Category:AHPA Practicals]]&lt;br /&gt;
[[File:AHPA Logo.gif|right|150x75px|link=http://www.ahpa.org/]]&lt;br /&gt;
===Introduction===&lt;br /&gt;
The American Herbal Products Association (AHPA) is providing here a review of analytical tools and methods used to authenticate the identity of raw materials labeled as star anise (''Illicium verum'' Hook. f.) fruit and for differentiating it from the fruit of toxic ''Illicium'' species including Japanese star anise (''Illicium anisatum'' L.).&lt;br /&gt;
&lt;br /&gt;
Japanese star anise has long been known to contain toxic principles and cases of poisoning have occurred from treatment of infant colic by administration of tea made from its toxic fruit instead of from the fruit of true star anise, which is also sometimes referred to as Chinese star anise. AHPA is providing this information as a technical information service to industry and not in response to any indication that there may be problems with food or supplement products containing star anise because supplements, beverage teas, and tea bags have not been implicated in reported poisoning cases.&lt;br /&gt;
&lt;br /&gt;
===Reports of Toxicity in Infants from Japanese Star Anise Tea===&lt;br /&gt;
&lt;br /&gt;
US reports of toxicity from administration of tea made from packaged spice material thought to be star anise to infants originated from the emergency room of the Miami Children’s Hospital.&amp;lt;ref&amp;gt;Ize-Ludlow D, Ragone S, Bruck IS, Bernstein JN, Duchowny M, Peña BM. Neurotoxicities in infants seen with the consumption of star anise tea. [http://pediatrics.aappublications.org/content/114/5/e653.full Pediatrics. 2004 Nov;114(5):e653-656]. (Free download at http://pediatrics.aappublications.org/content/114/5/e653.full, accessed November 11, 2011) &amp;lt;/ref&amp;gt; This led to the issuance of an FDA advisory to the public not to consume &amp;quot;teas&amp;quot; brewed from star anise.&amp;lt;ref&amp;gt;http://www.fda.gov/ICECI/EnforcementActions/EnforcementStory/EnforcementStoryArchive/ucm095929.htm accessed November 11, 2011.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The original advisory “noted that FDA’s concern that the commonly available Chinese star anise (''Illicium verum''), a product considered by FDA to be generally recognized as safe (GRAS), may contain Japanese star anise (''Illicium anisatum''). Japanese star anise has long been recognized as toxic in many countries and should be used for decorative purposes only.”&lt;br /&gt;
&lt;br /&gt;
Other reports of poisoning in infants from consumption of tea brewed from “star anise” have come from France,&amp;lt;ref&amp;gt;Minodier P, Pommier P, Moulène E, Retornaz K, Prost N, Deharo L. Intoxication aiguë par la badiane chez le nourrisson. [Star anise poisoning in infants]. [http://www.sciencedirect.com/science/article/pii/S0929693X03002744 Arch Pediatr. 2003 Jul;10(7):619-921]. [Article in French]&amp;lt;/ref&amp;gt; Spain,&amp;lt;ref&amp;gt;Garzo Fernández C, Gómez Pintado P, Barrasa Blanco A, Martínez Arrieta R, Ramírez Fernández R, Ramón Rosa F; Grupo de Trabajo del Anis Estrellado. Casos de enfermedad de sintomatología neurológica asociados al consumo de anís estrellado empleado como carminativo. [Cases of neurological symptoms associated with star anise consumption used as a carminative]. [Article in Spanish] [http://www.elsevier.es/en/revistas/anales-pediatria-37/cases-of-neurological-symptoms-associated-with-star-13036906-originales-2002 An Esp Pediatr. 2002 Oct;57(4):290-294].&amp;lt;/ref&amp;gt;&amp;lt;ref&amp;gt;Gil Campos M, Pérez Navero JL, Ibarra De La Rosa I. Crisis convulsiva secundaria a intoxicación por anís estrellado en un lactante. [Convulsive status secondary to star anise poisoning in a neonate]. [Article in Spanish] [http://www.elsevier.es/en/revistas/anales-pediatria-37/convulsive-status-secondary-to-star-anis-poisoning-13036924-notas-clinicas-2002 An Esp Pediatr. 2002 Oct;57(4):366-368].&amp;lt;/ref&amp;gt; and more recently Switzerland.&amp;lt;ref&amp;gt;Perret C, Tabin R, Marcoz JP, Llor J, Cheseaux JJ. Malaise du nourrisson pensez à une intoxication à l’anis étoilé. [Apparent life-threatening event in infants: think about star anise intoxication!]. [Article in French] [http://www.sciencedirect.com/science/article/pii/S0929693X11001618 Arch Pediatr. 2011 Jul;18(7):750-753].&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Comprehensive Star Anise Review===&lt;br /&gt;
&lt;br /&gt;
A comprehensive review that identifies poisonous star anise (''Illicium lanceolatum'' A. C. Smith) in addition to the highly toxic Japanese star anise (''I. anisatum'' L.) as potential adulterants to the true (Chinese) star anise (''I. verum'') has recently been published. This review also summarizes the botany, traditional use, phytochemistry and toxicology of star anise, long recognized for its safe medicinal and food use.&amp;lt;ref&amp;gt;Wang GW, Hu WT, Huang BK, Qin LP. Illicium verum: a review on its botany, traditional use, chemistry and pharmacology. [http://www.sciencedirect.com/science/article/pii/S0378874111003035 J Ethnopharmacol. 2011 Jun 14;136(1):10-20].&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Review of Some General Methods for Authentication of Star Anise Fruit===&lt;br /&gt;
&lt;br /&gt;
====Morphology and microscopy====&lt;br /&gt;
Differences between whole ''I. verum'' and ''I. anisatum'' fruit are relatively minor and differentiation between them on physical characteristics is difficult and may be inconclusive when they could be present as mixtures. This is also true of microscopic characteristics where the detection of ''I. anisatum'' in powdered material by this means alone has been found to be very limited.&amp;lt;ref&amp;gt;Fritz E, Ölzant SM, Länger R. ''Illicium verum'' Hook. f. and ''Illicium anisatum'' L.: Anatomical characters and their value for differentiation. [http://www.scipharm.at/default.asp?id=237&amp;amp;lid=2 Sci Pharm. 2008;76(1):65–76]. (Free download at http://www.scipharm.at/download.asp?id=230 accessed November 11, 2011).&amp;lt;/ref&amp;gt; However the identity verification of Chinese star anise dried fruit when obtained as homogeneous lots from known sources can be reasonably conducted. Observable macroscopic differences in the shape of the follicles and pedicles, and the taste of the dried fruit, can allow for an appropriate identity confirmation of true star anise. &lt;br /&gt;
&lt;br /&gt;
Macroscopic and organoleptic descriptions of ''Illicium'' species can be located in historical references available from http://books.google.com though the nomenclature in historical references may be misleading because ''I. anisatum'' L. was better known as ''I. religiosum'' Siebold &amp;amp; Zucc. and ''I. verum'' Hook f. was often referred to as ''I. anisatum'' Lour.!&amp;lt;ref&amp;gt;Culbreth, D.M.R. (1896) A Manual of Materia Medica and Pharmacology: Comprising all organic and inorganic drugs which are or have been official in the United States Pharmacopœia together with important allied species and useful synthetics, especially designed for students of pharmacy and medicine, as well as for druggists, pharmacists, and physicians. Lea Brothers &amp;amp; Co., Philadelphia and NY, p. 57-59. &amp;lt;/ref&amp;gt;&amp;lt;ref&amp;gt;Maisch, J.M (1882) A Manual of Organic Materia Medica: Being a guide to materia medica of the vegetable and animal kingdoms for the use of students, druggists, pharmacists, and physicians. Henry C. Lea’s Son &amp;amp; Co., Philadelphia, p. 295-296.&amp;lt;/ref&amp;gt; The confusing nomenclature regarding common and Latin names for these two species has been addressed elsewhere.&amp;lt;ref&amp;gt;Small E. Confusion of common names for toxic and edible “star anise” (''Illicium'') species. Econ Bot. 1996;50(3):337-339.&amp;lt;/ref&amp;gt; Macroscopic and microscopic images of ''I. verum'' fruit are available [http://ahpa.org/Portals/0/pdfs/Star%20Anise%20Microscopic%20Authentication.pdf HERE].&lt;br /&gt;
&lt;br /&gt;
====Color test====&lt;br /&gt;
&lt;br /&gt;
Chemical tests can be reliable methods to distinguish the fruits of ''I. verum'' and ''I. anisatum'', and may directly assess safety between materials if they quantify the content of the sesquiterpene lactone anisatin, which is thought to be responsible for the toxicity of ''I. anisatum'' fruit and seeds.&lt;br /&gt;
&lt;br /&gt;
Chemical differences between species can also cause different results in color test reactions such as was described for star anise in 1962.&amp;lt;ref&amp;gt;hang SE, Dutt MC, Tee TS. A colour test to distinguish between the fruits of ''Illicium verum'' and ''Illicium anisatum'' L. [http://onlinelibrary.wiley.com/doi/10.1111/j.2042-7158.1962.tb11061.x/abstract J Pharm Pharmacol. 1962 Feb;14:108-109].&amp;lt;/ref&amp;gt; This test procedure distinguishes the fruits of ''I. verum'' from those of ''I. anisatum'' by employing an acid-base extraction of distilled essential oil followed by the addition of orthophosphoric acid and phloroglucinol. The light yellow color of the solution made from treatment of ''I. verum'' from will change to pink within 5-10 min, and darken upon standing, while that produced from ''I. anisatum'' remains yellow.&lt;br /&gt;
&lt;br /&gt;
====Fluorescent microscopy (and GC-FID)====&lt;br /&gt;
&lt;br /&gt;
Other researchers reported the ability to clearly differentiate ''I. verum'' from ''I. anisatum'' fruit powder, including in a 1:1 mixture, via fluorescent microscopy. This group also developed a gas chromatographic (GC) method employing a flame ionization detector (FID) that easily differentiated simple extracts of these materials, including the detection of 10% ''I. anisatum'' fruit powder in a 10:90 mixture with ''I. verum'' fruit powder, due to the presence of methoxyeugenol, eugenol, and 2,6-dimethoxy-4-allylphenol in the former and not the latter.&amp;lt;ref&amp;gt;Joshi VC, Srinivas PV, Khan IA. Rapid and easy identification of ''Illicium verum'' Hook. f. and its adulterant ''Illicium anisatum'' Linn. by fluorescent microscopy and gas chromatography. [http://aoac.publisher.ingentaconnect.com/content/aoac/jaoac/2005/00000088/00000003/art00005 J AOAC Int. 2005 May-Jun;88(3):703-706].&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
====GC-MS====&lt;br /&gt;
&lt;br /&gt;
Other work conducted by researchers at the Royal Botanic Gardens, Kew, United Kingdom, employed thermal desorption followed by gas chromatography with a mass spectrometry detector (GC-MS) in a method that does not require distillation of star anise essential oil prior to analysis.&amp;lt;ref&amp;gt;Howes MJ, Kite GC, Simmonds MS. Distinguishing Chinese star anise from Japanese star anise using thermal desorption-gas chromatography-mass spectrometry. [http://pubs.acs.org/doi/abs/10.1021/jf9009153 J Agric Food Chem. 2009 Jul 8;57(13):5783-5789].&amp;lt;/ref&amp;gt; Although various samples of eight ''Illicium'' species were tested by this method, the authors did not report results conclusively differentiating the species, instead stating that the technique “can assist with the differentiation between fruit obtained from ''I. verum'' and the more toxic ''I. anisatum''.”&lt;br /&gt;
&lt;br /&gt;
====Liquid Chromatographic Methods for Authentication of Star Anise Fruit====&lt;br /&gt;
&lt;br /&gt;
=====TLC===== &lt;br /&gt;
&lt;br /&gt;
AHPA member company PhytoLab of Germany considered published GC methods inadequate because they do not include determination of the toxic constituent anisatin. Their published report contains a differentiation of several ''Illicium'' species based on thin layer chromatography (TLC), in which ''I. verum'' can be clearly differentiated, and of which they were similarly critical. (An HPTLC method and an example of results from analysis of ''I. verum'' and ''I. anisatum'' dried fruit is available [http://ahpa.org/Portals/0/pdfs/12_0119_Star%20Anise%20HPTLC%20Authentication%20rev.pdf HERE].)&lt;br /&gt;
&lt;br /&gt;
=====HPLC-MS/MS=====&lt;br /&gt;
[[Category:HPLC]]&lt;br /&gt;
In response, they developed and validated a fast, selective, and sensitive method that can determine low adulterations of toxic ''Illicium'' species and detect toxic sesquiterpene lactones using high-performance liquid chromatography with tandem mass spectrometry detection (HPLC-MS/MS).&amp;lt;ref&amp;gt;Lederer I, Schulzki G, Gross J, Steffen JP. Combination of TLC and HPLC-MS/MS methods. Approach to a rational quality control of Chinese star anise. [http://pubs.acs.org/doi/abs/10.1021/jf058156b J Agric Food Chem. 2006 Mar 22;54(6):1970-1974].&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This technique was used to measure the anisatin content of seven ''Illicium'' species, all of which, including ''I. verum'', were shown to contain anisatin in various amounts. However, due to the low concentration of anisatin found in ''I. verum'' dried fruit samples (up to 0.3 ppm) relative to other species, and establishing a specification of a maximum of 1 ppm for quality control product release, quantification of this constituent by the reported method can insure that a batch of star anise contains less than 0.1% of ''I. anisatum''.&lt;br /&gt;
&lt;br /&gt;
PhytoLab highly qualified reference standard anisatin is available in the US through Cerilliant® (http://www.cerilliant.com/).&lt;br /&gt;
&lt;br /&gt;
====DNA====&lt;br /&gt;
[[Category:DNA]]&lt;br /&gt;
Multiple genetic methods are available to both identify and quantify the presence and abundance of ''Illicium'' species in a sample.  DNA sequencing and restriction fragment length polymorphism (RFLP) methods have been demonstrated by researchers at the US Department of Agriculture and the University of Mississippi’s National Center for Natural Products Research to unambiguously identify and differentiate ''I. verum'' from ''I. anisatum'', as well as to detect mixed samples.&amp;lt;ref&amp;gt;Techen N, Pan Z, Scheffler BE, Khan IA. Detection of ''Illicium anisatum'' as adulterant of ''Illicium verum''. [https://doi.org/10.1055/s-0028-1112219 Planta Med. 2009 Mar;75(4):392-395].&amp;lt;/ref&amp;gt; In combination with real-time PCR methods, as described in a recent paper by researchers a forensic laboratory in Japan, quantification of ''Illicium'' species in a mixture is also possible.&amp;lt;ref&amp;gt;Matsuyama S, Nishi K. Genus identification of toxic plant by real-time PCR. [http://www.springerlink.com/content/x6uu571715r20618/ Int J Legal Med. 2011 Mar;125:211-217].&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Other Relevant Sources of Star Anise Information===&lt;br /&gt;
&lt;br /&gt;
====AHP and EP monographs====&lt;br /&gt;
&lt;br /&gt;
The American Herbal Pharmacopoeia and Therapeutic Compendium has published a star anise fruit monograph that includes organoleptic, macroscopic, and microscopic descriptors; other methods of analysis including HPTLC of authenticated materials; quality control; and therapeutic information. It can be ordered through http://www.herbal-ahp.org/order_online.htm. The European Pharmacopoeia also has identity and purity tests in the star anise monograph.&lt;br /&gt;
&lt;br /&gt;
===Analytical Considerations Based on Material Form===&lt;br /&gt;
&lt;br /&gt;
====Whole dried fruit====&lt;br /&gt;
&lt;br /&gt;
This form of star anise contains DNA, chemical, microscopic, and macroscopic information and can be subjected to all the tests previously described. If assurance is present that a lot in question is homogeneous with regard to species, a macroscopic inspection of follicles and pedicles and evaluation by taste can provide a perfectly acceptable method of identity verification of (Chinese) star anise (''I. verum'') dried whole fruit.&lt;br /&gt;
&lt;br /&gt;
====Fruit pieces, powdered fruit, possible mixtures, essential oils====&lt;br /&gt;
&lt;br /&gt;
Due to few differentiating macroscopic and microscopic characteristics, testing star anise fruit pieces or powder for adulteration is best accomplished via chromatographic or DNA technologies. DNA is can be particularly useful for detecting the presence of trace amounts of potentially adulterating species. The color test previously described may also be useful.&lt;br /&gt;
&lt;br /&gt;
Gas chromatic analysis of the material’s essential oil can aid determination of adulteration by detecting constituents from ''I. anisatum'' that are not present in ''I. verum''. Differentiation among several ''Illicium'' species is also possible using a TLC method. The availability of liquid chromatography tandem mass spectrometry allows for direct measurement of anisatin, the major toxic compound in ''I. anisatum'' fruit.&lt;br /&gt;
&lt;br /&gt;
Any technology/methodology chosen to authenticate star anise must match the particulars of the task at hand. This can be done with a thorough knowledge of the capabilities and limitations of each technology/methodology combined with an understanding of the origin of the material, its form, and potential adulterants. Readers are encouraged to directly consult the literature for more information.&lt;br /&gt;
&lt;br /&gt;
===Acknowledgements===&lt;br /&gt;
&lt;br /&gt;
Elan and Sidney Sudberg of Alkemist Labs in Costa Mesa, CA are acknowledged for providing the macroscopic and microscopic images, and the HPLTC method and image; Danica Reynaud of AuthenTechnologies in Albany, CA for information on analysis by DNA; Matthew Creswell of Oregon’s Wild Harvest in Sandy, OR for attention to historical references; Klaus Reif of PhytoLab in Germany for their method and identification of a standard source of anisatin; and to the membership of AHPA Analytical Laboratories, and Standards committees for their review of this information.&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)</id>
		<title>Dalbergia nigra (timber)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)"/>
				<updated>2017-09-07T22:40:21Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: fix category tag so page is listed correctly&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Dalbergia nigra'' (timber)}}  {{askbox|herb=''Dalbergia nigra''}}&lt;br /&gt;
[[Category:Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Dalbergia nigra&lt;br /&gt;
|authority=(Vell.) Allemão ex Benth.&lt;br /&gt;
|family=Leguminosae&lt;br /&gt;
|scn=Brazilian Rosewood&lt;br /&gt;
|aka=Jacaranda&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=Heartwood [... has a] fragrant rose-like odor, taste distinctive.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Heartwood is various shades of brown to chocolate or violet irregularly and conspicuously streaked with black; dark specimens with oily or waxy appearance and feel; sharply demarcated from the white sapwood. Grain generally straight; texture medium to rather coarse; luster medium...&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|{{media |cat=Microscopy&lt;br /&gt;
|companyimage=US Forest Products Laboratory.png&lt;br /&gt;
             | companyURL=https://www.fpl.fs.fed.us/products/publications/several_pubs.php?grouping_id=100&amp;amp;header_id=p&lt;br /&gt;
|mainimage=Dalbergia nigra micrograph (stained) x15 - US Forest Products Laboratory.png&lt;br /&gt;
            | caption1=Dalbergia nigra micrograph (stained) x15&lt;br /&gt;
           |source=Bergman, Richard et al. 2010.  Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory.}}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:US_Forest_Products_Laboratory.png</id>
		<title>File:US Forest Products Laboratory.png</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:US_Forest_Products_Laboratory.png"/>
				<updated>2017-09-07T22:39:15Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: USFPL logo from the US Forest Products Laboratory's 2010 text: Wood Handbook, Wood as an Engineering Material (All Chapters)

Publication: Forest Products Laboratory. Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;USFPL logo from the US Forest Products Laboratory's 2010 text: Wood Handbook, Wood as an Engineering Material (All Chapters)&lt;br /&gt;
&lt;br /&gt;
Publication: Forest Products Laboratory. Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory: 508 p. 2010&lt;br /&gt;
Author(s)  Bergman, Richard; Cai, Zhiyong; Carll, Charlie G.; Clausen, Carol A.; Dietenberger, Mark A.; Falk, Robert H.; Frihart, Charles R.; Glass, Samuel V.; Hunt, Christopher G.; Ibach, Rebecca E.; Kretschmann, David E.; Rammer, Douglas R.; Ross, Robert J.; Star et al.&lt;br /&gt;
Year: 2010&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)</id>
		<title>Dalbergia nigra (timber)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)"/>
				<updated>2017-09-07T22:38:54Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: fix filetype for USFPL logo&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Dalbergia nigra'' (timber)}}  {{askbox|herb=''Dalbergia nigra''}}&lt;br /&gt;
[Category=Timber]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Dalbergia nigra&lt;br /&gt;
|authority=(Vell.) Allemão ex Benth.&lt;br /&gt;
|family=Leguminosae&lt;br /&gt;
|scn=Brazilian Rosewood&lt;br /&gt;
|aka=Jacaranda&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=Heartwood [... has a] fragrant rose-like odor, taste distinctive.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Heartwood is various shades of brown to chocolate or violet irregularly and conspicuously streaked with black; dark specimens with oily or waxy appearance and feel; sharply demarcated from the white sapwood. Grain generally straight; texture medium to rather coarse; luster medium...&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|{{media |cat=Microscopy&lt;br /&gt;
|companyimage=US Forest Products Laboratory.png&lt;br /&gt;
             | companyURL=https://www.fpl.fs.fed.us/products/publications/several_pubs.php?grouping_id=100&amp;amp;header_id=p&lt;br /&gt;
|mainimage=Dalbergia nigra micrograph (stained) x15 - US Forest Products Laboratory.png&lt;br /&gt;
            | caption1=Dalbergia nigra micrograph (stained) x15&lt;br /&gt;
           |source=Bergman, Richard et al. 2010.  Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory.}}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Dalbergia_nigra_micrograph_(stained)_x15_-_US_Forest_Products_Laboratory.png</id>
		<title>File:Dalbergia nigra micrograph (stained) x15 - US Forest Products Laboratory.png</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Dalbergia_nigra_micrograph_(stained)_x15_-_US_Forest_Products_Laboratory.png"/>
				<updated>2017-09-07T22:33:58Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Dalbergia nigra micrograph (stained) x15

From  Bergman, Richard; Cai, Zhiyong; Carll, Charlie G.; Clausen, Carol A.; Dietenberger, Mark A.; Falk, Robert H.; Frihart, Charles R.; Glass, Samuel V.; Hunt, Christopher G.; Ibach, Rebecca E.; Kretschmann, D...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Dalbergia nigra micrograph (stained) x15&lt;br /&gt;
&lt;br /&gt;
From  Bergman, Richard; Cai, Zhiyong; Carll, Charlie G.; Clausen, Carol A.; Dietenberger, Mark A.; Falk, Robert H.; Frihart, Charles R.; Glass, Samuel V.; Hunt, Christopher G.; Ibach, Rebecca E.; Kretschmann, David E.; Rammer, Douglas R.; Ross, Robert J.; et al. 2010.  Forest Products Laboratory. &lt;br /&gt;
&lt;br /&gt;
Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory: 508 p. 2010&lt;br /&gt;
&lt;br /&gt;
https://www.fpl.fs.fed.us/products/publications/several_pubs.php?grouping_id=100&amp;amp;header_id=p&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)</id>
		<title>Dalbergia nigra (timber)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)"/>
				<updated>2017-09-07T22:30:34Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: fix formatting error&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Dalbergia nigra'' (timber)}}  {{askbox|herb=''Dalbergia nigra''}}&lt;br /&gt;
[[Category=Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Dalbergia nigra&lt;br /&gt;
|authority=(Vell.) Allemão ex Benth.&lt;br /&gt;
|family=Leguminosae&lt;br /&gt;
|scn=Brazilian Rosewood&lt;br /&gt;
|aka=Jacaranda&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=Heartwood [... has a] fragrant rose-like odor, taste distinctive.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Heartwood is various shades of brown to chocolate or violet irregularly and conspicuously streaked with black; dark specimens with oily or waxy appearance and feel; sharply demarcated from the white sapwood. Grain generally straight; texture medium to rather coarse; luster medium...&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|{{media |cat=Microscopy&lt;br /&gt;
|companyimage=US Forest Products Laboratory.jpg&lt;br /&gt;
             | companyURL=https://www.fpl.fs.fed.us/products/publications/several_pubs.php?grouping_id=100&amp;amp;header_id=p&lt;br /&gt;
|mainimage=Dalbergia nigra micrograph (stained) x15 - US Forest Products Laboratory.png&lt;br /&gt;
            | caption1=Dalbergia nigra micrograph (stained) x15&lt;br /&gt;
           |source=Bergman, Richard et al. 2010.  Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory.}}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)</id>
		<title>Dalbergia nigra (timber)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)"/>
				<updated>2017-09-07T22:29:57Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: add micrograph&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Dalbergia nigra'' (timber)}}  {{askbox|herb=''Dalbergia nigra''}}&lt;br /&gt;
[[Category=Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Dalbergia nigra&lt;br /&gt;
|authority=(Vell.) Allemão ex Benth.&lt;br /&gt;
|family=Leguminosae&lt;br /&gt;
|scn=Brazilian Rosewood&lt;br /&gt;
|aka=Jacaranda&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=Heartwood [... has a] fragrant rose-like odor, taste distinctive.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Heartwood is various shades of brown to chocolate or violet irregularly and conspicuously streaked with black; dark specimens with oily or waxy appearance and feel; sharply demarcated from the white sapwood. Grain generally straight; texture medium to rather coarse; luster medium...&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{{media |cat=Microscopy&lt;br /&gt;
|companyimage=US Forest Products Laboratory.jpg&lt;br /&gt;
             | companyURL=https://www.fpl.fs.fed.us/products/publications/several_pubs.php?grouping_id=100&amp;amp;header_id=p&lt;br /&gt;
|mainimage=Dalbergia nigra micrograph (stained) x15 - US Forest Products Laboratory.png&lt;br /&gt;
            | caption1=Dalbergia nigra micrograph (stained) x15&lt;br /&gt;
           |source=Bergman, Richard et al. 2010.  Wood handbook - Wood as an engineering material. General Technical Report FPL-GTR-190. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory.}&lt;br /&gt;
|}&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)</id>
		<title>Dalbergia nigra (timber)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Dalbergia_nigra_(timber)"/>
				<updated>2017-09-07T21:24:39Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: add timber entry outline for dalbergia&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Dalbergia nigra'' (timber)}}  {{askbox|herb=''Dalbergia nigra''}}&lt;br /&gt;
[[Category=Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Dalbergia nigra&lt;br /&gt;
|authority=(Vell.) Allemão ex Benth.&lt;br /&gt;
|family=Leguminosae&lt;br /&gt;
|scn=Brazilian Rosewood&lt;br /&gt;
|aka=Jacaranda&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
{{Organolepsy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=Heartwood [... has a] fragrant rose-like odor, taste distinctive.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=Chudnoff, Martin. 1984. Tropical Timbers of the World. USDA Forest Service. Ag. Handbook No. 607.&lt;br /&gt;
| description=&lt;br /&gt;
&amp;quot;Heartwood is various shades of brown to chocolate or violet irregularly and conspicuously streaked with black; dark specimens with oily or waxy appearance and feel; sharply demarcated from the white sapwood. Grain generally straight; texture medium to rather coarse; luster medium...&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=DNA Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
==Other Publications==&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-09-06T17:35:48Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: correct 'timber' demonstration category&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
| companyimage=wisconsin-madison.gif&lt;br /&gt;
             | companyURL=http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729&lt;br /&gt;
|mainimage=Salix nigra sp67125044399810745359.att.JPG&lt;br /&gt;
|caption1=''Salix nigra'' L.&lt;br /&gt;
           |source=Online Virtual Flora of Wisconsin. 2017. Accessed August 24.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T21:47:58Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
[[Category:Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
| companyimage=wisconsin-madison.gif&lt;br /&gt;
             | companyURL=http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729&lt;br /&gt;
|mainimage=Salix nigra sp67125044399810745359.att.JPG&lt;br /&gt;
|caption1=''Salix nigra'' L.&lt;br /&gt;
           |source=Online Virtual Flora of Wisconsin. 2017. Accessed August 24.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/MediaWiki:Sidebar</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/MediaWiki:Sidebar"/>
				<updated>2017-08-24T21:43:09Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: correct Timber products -&amp;gt; Timber entries&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*navigation &lt;br /&gt;
**mainpage|Main&lt;br /&gt;
**Category:Botanical|All botanicals&lt;br /&gt;
**Category:Voucher|Botanical Vouchers&lt;br /&gt;
**Category:Organolepsy|Organoleptic entries&lt;br /&gt;
**Category:Macroscopy|Macroscopy entries&lt;br /&gt;
**Category:Microscopy|Microscopy entries&lt;br /&gt;
**Category:HPLC|HPLC entries&lt;br /&gt;
**Category:HPTLC|HPTLC entries&lt;br /&gt;
**Category:DNA|DNA entries&lt;br /&gt;
**Category:Timber|Timber entries&lt;br /&gt;
**Category:AHPA_Known_Adulterants|AHPA Known Adulterants guidances&lt;br /&gt;
**Category:AHPA Practicals|AHPA practicals (white papers)&lt;br /&gt;
**portal-url|portal &lt;br /&gt;
**currentevents-url|currentevents &lt;br /&gt;
**recentchanges-url|recentchanges &lt;br /&gt;
**randompage-url|randompage &lt;br /&gt;
**helppage|help   &lt;br /&gt;
*SEARCH &lt;br /&gt;
*SUPPORTED BY&lt;br /&gt;
**sponsors-url|sponsors &lt;br /&gt;
**Botanical Reference Materials|Botanical reference materials&lt;br /&gt;
*TOOLBOX &lt;br /&gt;
*LANGUAGES&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T21:41:49Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: correct citation re: usage policy&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
[[Category:Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
| companyimage=wisconsin-madison.gif&lt;br /&gt;
             | companyURL=http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729&lt;br /&gt;
|mainimage=Salix nigra sp67125044399810745359.att.JPG&lt;br /&gt;
           |source=Online Virtual Flora of Wisconsin. 2017. Accessed August 24.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T21:38:34Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Add Timber category for demo&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
[[Category:Timber]]&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
| companyimage=wisconsin-madison.gif&lt;br /&gt;
             | companyURL=http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729&lt;br /&gt;
|mainimage=Salix nigra sp67125044399810745359.att.JPG&lt;br /&gt;
           |source=University of Wisconsin - Madison&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Wisconsin-madison.gif</id>
		<title>File:Wisconsin-madison.gif</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Wisconsin-madison.gif"/>
				<updated>2017-08-24T21:35:15Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Admin uploaded a new version of &amp;amp;quot;File:Wisconsin-madison.gif&amp;amp;quot;: Flora of Wisconsin consortium banner (accessed 8/24/2017)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Resource from University of Wisconsin - Madison / Online Virtual Flora of Wisconsin&lt;br /&gt;
&lt;br /&gt;
http://wisflora.herbarium.wisc.edu/index.php is a collaborative effort between the herbaria of the UW-Madison (WIS) and the UW-Steven's Point (UWSP), along with most of the other herbaria located in the state of Wisconsin. It contains information on each of the more than 2600 vascular plant species that occurs in Wisconsin, including photos, distribution maps, specimen records, and more.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Salix_nigra_sp67125044399810745359.att.JPG</id>
		<title>File:Salix nigra sp67125044399810745359.att.JPG</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Salix_nigra_sp67125044399810745359.att.JPG"/>
				<updated>2017-08-24T21:31:52Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Via Flora of Wisconsin: http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729 (accessed 8/24/2017)

University of Wisconsin - Madison
Catalog #: v0324506WIS
Occurrence ID (GUID): ae622d7e-f95b-11e2-9dec-002590257708
Taxon: Sa...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Via Flora of Wisconsin: http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729 (accessed 8/24/2017)&lt;br /&gt;
&lt;br /&gt;
University of Wisconsin - Madison&lt;br /&gt;
Catalog #: v0324506WIS&lt;br /&gt;
Occurrence ID (GUID): ae622d7e-f95b-11e2-9dec-002590257708&lt;br /&gt;
Taxon: Salix nigra Marshall	&lt;br /&gt;
Family: Salicaceae&lt;br /&gt;
Collector: Haugh, Kari   155   &lt;br /&gt;
Date: 04 August 1981&lt;br /&gt;
Locality: United States, Wisconsin, Iowa, Hwy 80, 0.6mi S of Livingston to County Line Rd. S Of Livingston on County Line Rd. S on County Line Rd. 1.1 mi to New California Rd. E on New California Rd. 0.5mi to Dave Rundall farm. N side of road.&lt;br /&gt;
42.87824387  -90.41795343 +-1138m.  28011&lt;br /&gt;
Verbatim Coordinates: T05N R01E sec30&lt;br /&gt;
Georeference Remarks: Latitude/Longitude was derived from the Township, Range, Section location. This causes an imprecision.&lt;br /&gt;
Habitat: N throught farmyard 0.4mi to mine dump piles on W side of road. Sandy loam and rocky substrate.&lt;br /&gt;
Notes: Voucher specimen. uwpl006419&lt;br /&gt;
Specimen Images&lt;br /&gt;
 &lt;br /&gt;
Record Id: b1130a2f-04d5-4a91-8d13-ccad6faa34ba&lt;br /&gt;
Usage Rights: CC0 1.0 (Public-domain)&lt;br /&gt;
For additional information on this specimen, please contact: Mary Ann Feist (mfeist@wisc.edu)&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Wisconsin-madison.gif</id>
		<title>File:Wisconsin-madison.gif</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Wisconsin-madison.gif"/>
				<updated>2017-08-24T21:30:13Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Resource from University of Wisconsin - Madison / Online Virtual Flora of Wisconsin

http://wisflora.herbarium.wisc.edu/index.php is a collaborative effort between the herbaria of the UW-Madison (WIS) and the UW-Steven's Point (UWSP), along with most o...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Resource from University of Wisconsin - Madison / Online Virtual Flora of Wisconsin&lt;br /&gt;
&lt;br /&gt;
http://wisflora.herbarium.wisc.edu/index.php is a collaborative effort between the herbaria of the UW-Madison (WIS) and the UW-Steven's Point (UWSP), along with most of the other herbaria located in the state of Wisconsin. It contains information on each of the more than 2600 vascular plant species that occurs in Wisconsin, including photos, distribution maps, specimen records, and more.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T21:28:58Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add voucher specimen from university of wisconsin herbarium */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
{{Media |cat=Voucher&lt;br /&gt;
| companyimage=wisconsin-madison.gif&lt;br /&gt;
             | companyURL=http://wisflora.herbarium.wisc.edu/collections/individual/index.php?occid=620729&lt;br /&gt;
|mainimage=Salix nigra sp67125044399810745359.att.JPG&lt;br /&gt;
           |source=University of Wisconsin - Madison&lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T20:08:59Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add USDA reference */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Department of Agriculture Natural Resources Conservation Service (2010) &lt;br /&gt;
| companyURL=https://plants.usda.gov/factsheet/pdf/fs_sani.pdf&lt;br /&gt;
| description=A member of the Willow Family (''Salicaceae''), black willow is a small to medium-sized tree 30 to 60 ft high and about 14 inches in diameter with a broad, irregular crown and a superficial root system.&lt;br /&gt;
&lt;br /&gt;
Leaves are simple, alternate, deciduous, narrow, lanceshaped, with tapered bases, rounded base, finely toothed margin, blade yellow-green on both sides, with a few small hairs on the lower surface; petiole slender. Flowers of black willow: male and female catkins on separate trees. Catkins are 4-5 cm long, on ends of leafy shoots, many small, yellow-green flowers without petals. Twigs are light-red, slender, and flexible. Buds narrow, conical, orange-brown; leaf scars narrow, crescent shaped; broad, flat, often shaggy ridges; pith pale brown, small. The bark is dark gray-brown to nearly blackish, divided into deep fissures separating thick, interlacing, sometimes scaly ridges.&lt;br /&gt;
&lt;br /&gt;
Black willow is adapted wherever ample soil moisture is found. Black willow grows best where the average annual rainfall is 51 inches, of which 20 inches falls during the growing season, April through August.  The estimated life span for black willow averages 65 years with a range of 40 to 100 years. The wood is of moderately light to light density, moderately soft. It does not splinter easily.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T19:55:15Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=Willow&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)</id>
		<title>Salix spp. (bark)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Salix_spp._(bark)"/>
				<updated>2017-08-24T19:54:54Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add nomenclature */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE: ''Salix'' spp. (bark) }} {{askbox|herb=''Salix'' spp.}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Salix spp.&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Ranunculaceae&lt;br /&gt;
|scn=Willow&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=[The black willow, ''Salix nigra'',] is a tree attaining a height of 120 feet and a trunk diameter of 3 feet, with narrow lance-shaped leaves 2 1/2 to 5 inches long and up to three-quarters of an inch wide, finely toothed and hairy when young.  Male and female flowers are bourne in separate catkins which expand with the leaves.  The male catkins 1 to 2 inches and the female catkins 1 1/2 to 3 inches long.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 1429.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1798.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:Timber</id>
		<title>Category:Timber</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:Timber"/>
				<updated>2017-08-24T19:47:34Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* UNDER CONSTRUCTION */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== [[Image:Timber.png|40px]][[:Category:Timber|Timber Category Listing]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Here is a reference to all timber entries which have currently been added to the AHPA Botanical Identity References Compendium.&lt;br /&gt;
&lt;br /&gt;
===UNDER CONSTRUCTION===&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:Timber</id>
		<title>Category:Timber</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:Timber"/>
				<updated>2017-08-24T19:47:24Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== [[Image:Timber.png|40px]][[:Category:Timber|Timber Category Listing]] ==&lt;br /&gt;
&lt;br /&gt;
===UNDER CONSTRUCTION===&lt;br /&gt;
&lt;br /&gt;
Here is a reference to all timber entries which have currently been added to the AHPA Botanical Identity References Compendium.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Category:Timber</id>
		<title>Category:Timber</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Category:Timber"/>
				<updated>2017-08-24T19:47:09Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* under construction placeholder for timber category */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== [[Image:Timber.png|40px]][[:Category:Timber|Timber Category Listing]] ==&lt;br /&gt;
&lt;br /&gt;
=UNDER CONSTRUCTION=&lt;br /&gt;
&lt;br /&gt;
Here is a reference to all timber entries which have currently been added to the AHPA Botanical Identity References Compendium.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/File:Timber.png</id>
		<title>File:Timber.png</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/File:Timber.png"/>
				<updated>2017-08-24T19:46:07Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: Placeholder logo for timber products/inc character for &amp;quot;wood&amp;quot; in Chinese&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Placeholder logo for timber products/inc character for &amp;quot;wood&amp;quot; in Chinese&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Template:Timber</id>
		<title>Template:Timber</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Template:Timber"/>
				<updated>2017-08-24T19:38:14Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;noinclude&amp;gt;&lt;br /&gt;
== Usage ==&lt;br /&gt;
Welcome:&lt;br /&gt;
&lt;br /&gt;
Here's a sample use of the Timber template.  Any of the categories may be omitted and will be replaced by a default message or hidden.&lt;br /&gt;
&lt;br /&gt;
It's best if you copy the source text by editing another entry from the same source.  This will prevent typographical errors from mis-categorizing your new entry.&lt;br /&gt;
&lt;br /&gt;
References using this template will ONLY cause them to appear in the &amp;quot;Timber products&amp;quot; category.  They will not be listed under any other categories unless they are inherited from a different template.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
{{Timber| source=Either Author/Year/Title/Edition for books, or your user/laboratory identification if the content is from your observations.&lt;br /&gt;
                     Ex: source=Schneider, A. (1921) The Microanalysis of Powdered Vegetable Drugs, 2nd ed.&lt;br /&gt;
             | mainimage=FilenameOfYourUploadedImageGoesHere.png&lt;br /&gt;
             | companyimage=YourCompanyBadge.jpg&lt;br /&gt;
             | companyURL=http://www.yourcompany.com/homepage/goeshere/&lt;br /&gt;
             | caption1=Description of your uploaded image (e.g. Yarrow (root) at 200x under polarized light, deionized water as solvent)&lt;br /&gt;
             | description=Yarrow (root) (''Achillea Millefolium'')&lt;br /&gt;
             | image2=Filename2.png&lt;br /&gt;
             | caption2=Description of Filename2.png (e.g. Whole plant picture, harvested while blooming.)&lt;br /&gt;
             | image3=Filename3.png&lt;br /&gt;
             | caption3=Optional description of Filename3.png &lt;br /&gt;
             | image4=Filename4.png&lt;br /&gt;
             | caption4=Optional description of Filename4.png &lt;br /&gt;
             | image5=Filename5.png&lt;br /&gt;
             | caption5=Optional description of Filename5.png &lt;br /&gt;
             | image6=Filename6.png&lt;br /&gt;
             | caption6=Optional description of Filename6.png &lt;br /&gt;
             | image7=Filename7.png&lt;br /&gt;
             | caption7=Optional description of Filename7.png &lt;br /&gt;
             | image8=Filename8.png&lt;br /&gt;
             | caption8=Optional description of Filename8.png &lt;br /&gt;
             | color=Grayish green.&lt;br /&gt;
             | flavor=Bitter, astringent, somewhat saline.&lt;br /&gt;
             | scent=Aromatically fragrant, resembling chamomille.&lt;br /&gt;
             | characteristics=Epidermal cells (upper and lower) of leaves tabular with wavy vertical walls.&lt;br /&gt;
               Hair cells simple with one to six basal cells and long apical cell; walls moderately thick, smooth.&lt;br /&gt;
               A few bladdery glandular hairs.  Stomata on upper and lower epidermis.&lt;br /&gt;
               Two or three rows of palisade cells.  Spongy tissue of spheroidal cells.&lt;br /&gt;
               Parenchyma, bast, tracheids, spiral ducts.  Fibers with prismatic crystals of calcium oxalate, from stems,&lt;br /&gt;
               petioles, and veins.  Pollen grains characteristic of the order..&lt;br /&gt;
             | ash=This section highly optional.&lt;br /&gt;
               Indicate percent ash if applicable; i.e. Ash should not exceed 12 percent.&lt;br /&gt;
             | adulterants=Also optional; note any observed adulterants present.&lt;br /&gt;
               Ex: On account of its cheapness and wide distribution, this drug is rarely adulterated.&lt;br /&gt;
               The following species indigenous to Europe are sometimes employed: ''A. ptarmica, A. aceratum,&lt;br /&gt;
               A. nobilis, A. moschata, A. atrata, A. Nana''.&lt;br /&gt;
             | substitutes=Any reported substitutes should appear here.&lt;br /&gt;
             | notes=Other notes should appear in this section.&lt;br /&gt;
             | reference=Reference work appears here.&lt;br /&gt;
             | }}&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;includeonly&amp;gt;[[Category:Botanical]]&amp;lt;/includeonly&amp;gt;&lt;br /&gt;
&amp;lt;includeonly&amp;gt;[[Category:{{{source}}}]]&amp;lt;/includeonly&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;noinclude&amp;gt;=={{{source|Uncredited Source}}}==&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
__FORCETOC__&lt;br /&gt;
__NOEDITSECTION__&lt;br /&gt;
{{ #if: {{{companyimage|}}} |[[File:{{{companyimage|}}}|right|150x75px|link={{{companyURL|}}}]]|[[Image:Timber.png|32px|left]]}}{{ #if: {{{mainimage|}}} |[[Image:{{{mainimage|Timber.png}}}|thumb|c|upright=3.0|{{{caption1|{{{description|Description not reported.}}}}}}]]|}}&lt;br /&gt;
&lt;br /&gt;
'''{{{description|Report Description as: Common-Name (Plant-Part) (''scientific name'').}}}'''{{ #if: {{{characteristics|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''General Characteristics'''&lt;br /&gt;
{{{characteristics}}}|}}{{ #if: {{{texture|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Texture'''&lt;br /&gt;
{{{texture}}}&lt;br /&gt;
|}}{{ #if: {{{color|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Color'''&lt;br /&gt;
{{{color}}}&lt;br /&gt;
|}}{{ #if: {{{scent|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Scent'''&lt;br /&gt;
{{{scent}}}&lt;br /&gt;
|}}{{ #if: {{{flavor|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Flavor'''&lt;br /&gt;
{{{flavor}}}&lt;br /&gt;
|}}{{ #if: {{{ash|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Ash Content'''&lt;br /&gt;
{{{ash}}}&lt;br /&gt;
|}}{{ #if: {{{adulterants|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Reported Adulterants'''&lt;br /&gt;
{{{adulterants|Not reported.}}}|}}{{ #if: {{{substitutes|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Possible Substitutes'''&lt;br /&gt;
{{{substitutes|Not reported.}}}|}}{{ #if: {{{reference|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Reference''' ''see'' &lt;br /&gt;
{{{reference}}}|}}{{ #if: {{{notes|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Other Notes'''&lt;br /&gt;
{{{notes|No notes reported.}}}|}} &lt;br /&gt;
{{ #if: {{{image2|}}} |&lt;br /&gt;
{{#tag:gallery|&lt;br /&gt;
File:{{{mainimage}}}{{!}}{{{caption1|{{{description|Description not reported.}}}}}}&lt;br /&gt;
File:{{{image2}}}{{ #if: {{{caption2|}}} |{{!}}{{{caption2}}}|}}&lt;br /&gt;
{{ #if: {{{image3|}}} |File:{{{image3}}}|}}{{ #if: {{{caption3|}}} |{{!}}{{{caption3}}}|}}&lt;br /&gt;
{{ #if: {{{image4|}}} |File:{{{image4}}}|}}{{ #if: {{{caption4|}}} |{{!}}{{{caption4}}}|}}&lt;br /&gt;
{{ #if: {{{image5|}}} |File:{{{image5}}}|}}{{ #if: {{{caption5|}}} |{{!}}{{{caption5}}}|}}&lt;br /&gt;
{{ #if: {{{image6|}}} |File:{{{image6}}}|}}{{ #if: {{{caption6|}}} |{{!}}{{{caption6}}}|}}&lt;br /&gt;
{{ #if: {{{image7|}}} |File:{{{image7}}}|}}{{ #if: {{{caption7|}}} |{{!}}{{{caption7}}}|}}&lt;br /&gt;
{{ #if: {{{image8|}}} |File:{{{image8}}}|}}{{ #if: {{{caption8|}}} |{{!}}{{{caption8}}}|}}&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}}&lt;br /&gt;
'''Source''': {{{source}}} {{#tag:ref|&lt;br /&gt;
{{{source}}} {{{companyURL|}}}&lt;br /&gt;
}}  &amp;lt;noinclude&amp;gt;Return to [[Image:Timber.png|20px]][[:Category:Timber|All Timber entries Category Listing]].&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&amp;lt;br style=&amp;quot;clear:both&amp;quot; /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Template:Timber</id>
		<title>Template:Timber</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Template:Timber"/>
				<updated>2017-08-24T19:37:38Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* new generic template based on current Botanical category */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;noinclude&amp;gt;&lt;br /&gt;
== Usage ==&lt;br /&gt;
Welcome:&lt;br /&gt;
&lt;br /&gt;
Here's a sample use of the Timber template.  Any of the categories may be omitted and will be replaced by a default message or hidden.&lt;br /&gt;
&lt;br /&gt;
It's best if you copy the source text by editing another entry from the same source.  This will prevent typographical errors from mis-categorizing your new entry.&lt;br /&gt;
&lt;br /&gt;
References using this template will ONLY cause them to appear in the &amp;quot;Timber products&amp;quot; category.  They will not be listed under any other categories unless they are inherited from a different template.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
{{Timber| source=Either Author/Year/Title/Edition for books, or your user/laboratory identification if the content is from your observations.&lt;br /&gt;
                     Ex: source=Schneider, A. (1921) The Microanalysis of Powdered Vegetable Drugs, 2nd ed.&lt;br /&gt;
             | mainimage=FilenameOfYourUploadedImageGoesHere.png&lt;br /&gt;
             | companyimage=YourCompanyBadge.jpg&lt;br /&gt;
             | companyURL=http://www.yourcompany.com/homepage/goeshere/&lt;br /&gt;
             | caption1=Description of your uploaded image (e.g. Yarrow (root) at 200x under polarized light, deionized water as solvent)&lt;br /&gt;
             | description=Yarrow (root) (''Achillea Millefolium'')&lt;br /&gt;
             | image2=Filename2.png&lt;br /&gt;
             | caption2=Description of Filename2.png (e.g. Whole plant picture, harvested while blooming.)&lt;br /&gt;
             | image3=Filename3.png&lt;br /&gt;
             | caption3=Optional description of Filename3.png &lt;br /&gt;
             | image4=Filename4.png&lt;br /&gt;
             | caption4=Optional description of Filename4.png &lt;br /&gt;
             | image5=Filename5.png&lt;br /&gt;
             | caption5=Optional description of Filename5.png &lt;br /&gt;
             | image6=Filename6.png&lt;br /&gt;
             | caption6=Optional description of Filename6.png &lt;br /&gt;
             | image7=Filename7.png&lt;br /&gt;
             | caption7=Optional description of Filename7.png &lt;br /&gt;
             | image8=Filename8.png&lt;br /&gt;
             | caption8=Optional description of Filename8.png &lt;br /&gt;
             | color=Grayish green.&lt;br /&gt;
             | flavor=Bitter, astringent, somewhat saline.&lt;br /&gt;
             | scent=Aromatically fragrant, resembling chamomille.&lt;br /&gt;
             | characteristics=Epidermal cells (upper and lower) of leaves tabular with wavy vertical walls.&lt;br /&gt;
               Hair cells simple with one to six basal cells and long apical cell; walls moderately thick, smooth.&lt;br /&gt;
               A few bladdery glandular hairs.  Stomata on upper and lower epidermis.&lt;br /&gt;
               Two or three rows of palisade cells.  Spongy tissue of spheroidal cells.&lt;br /&gt;
               Parenchyma, bast, tracheids, spiral ducts.  Fibers with prismatic crystals of calcium oxalate, from stems,&lt;br /&gt;
               petioles, and veins.  Pollen grains characteristic of the order..&lt;br /&gt;
             | ash=This section highly optional.&lt;br /&gt;
               Indicate percent ash if applicable; i.e. Ash should not exceed 12 percent.&lt;br /&gt;
             | adulterants=Also optional; note any observed adulterants present.&lt;br /&gt;
               Ex: On account of its cheapness and wide distribution, this drug is rarely adulterated.&lt;br /&gt;
               The following species indigenous to Europe are sometimes employed: ''A. ptarmica, A. aceratum,&lt;br /&gt;
               A. nobilis, A. moschata, A. atrata, A. Nana''.&lt;br /&gt;
             | substitutes=Any reported substitutes should appear here.&lt;br /&gt;
             | notes=Other notes should appear in this section.&lt;br /&gt;
             | reference=Reference work appears here.&lt;br /&gt;
             | }}&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;includeonly&amp;gt;[[Category:Botanical]]&amp;lt;/includeonly&amp;gt;&lt;br /&gt;
&amp;lt;includeonly&amp;gt;[[Category:{{{source}}}]]&amp;lt;/includeonly&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;noinclude&amp;gt;=={{{source|Uncredited Source}}}==&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
__FORCETOC__&lt;br /&gt;
__NOEDITSECTION__&lt;br /&gt;
{{ #if: {{{companyimage|}}} |[[File:{{{companyimage|}}}|right|150x75px|link={{{companyURL|}}}]]|[[Image:Botanical.png|32px|left]]}}{{ #if: {{{mainimage|}}} |[[Image:{{{mainimage|Botanical.png}}}|thumb|c|upright=3.0|{{{caption1|{{{description|Description not reported.}}}}}}]]|}}&lt;br /&gt;
&lt;br /&gt;
'''{{{description|Report Description as: Common-Name (Plant-Part) (''scientific name'').}}}'''{{ #if: {{{characteristics|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''General Characteristics'''&lt;br /&gt;
{{{characteristics}}}|}}{{ #if: {{{texture|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Texture'''&lt;br /&gt;
{{{texture}}}&lt;br /&gt;
|}}{{ #if: {{{color|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Color'''&lt;br /&gt;
{{{color}}}&lt;br /&gt;
|}}{{ #if: {{{scent|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Scent'''&lt;br /&gt;
{{{scent}}}&lt;br /&gt;
|}}{{ #if: {{{flavor|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Flavor'''&lt;br /&gt;
{{{flavor}}}&lt;br /&gt;
|}}{{ #if: {{{ash|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Ash Content'''&lt;br /&gt;
{{{ash}}}&lt;br /&gt;
|}}{{ #if: {{{adulterants|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Reported Adulterants'''&lt;br /&gt;
{{{adulterants|Not reported.}}}|}}{{ #if: {{{substitutes|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Possible Substitutes'''&lt;br /&gt;
{{{substitutes|Not reported.}}}|}}{{ #if: {{{reference|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Reference''' ''see'' &lt;br /&gt;
{{{reference}}}|}}{{ #if: {{{notes|}}} |&amp;amp;nbsp;&lt;br /&gt;
&lt;br /&gt;
'''Other Notes'''&lt;br /&gt;
{{{notes|No notes reported.}}}|}} &lt;br /&gt;
{{ #if: {{{image2|}}} |&lt;br /&gt;
{{#tag:gallery|&lt;br /&gt;
File:{{{mainimage}}}{{!}}{{{caption1|{{{description|Description not reported.}}}}}}&lt;br /&gt;
File:{{{image2}}}{{ #if: {{{caption2|}}} |{{!}}{{{caption2}}}|}}&lt;br /&gt;
{{ #if: {{{image3|}}} |File:{{{image3}}}|}}{{ #if: {{{caption3|}}} |{{!}}{{{caption3}}}|}}&lt;br /&gt;
{{ #if: {{{image4|}}} |File:{{{image4}}}|}}{{ #if: {{{caption4|}}} |{{!}}{{{caption4}}}|}}&lt;br /&gt;
{{ #if: {{{image5|}}} |File:{{{image5}}}|}}{{ #if: {{{caption5|}}} |{{!}}{{{caption5}}}|}}&lt;br /&gt;
{{ #if: {{{image6|}}} |File:{{{image6}}}|}}{{ #if: {{{caption6|}}} |{{!}}{{{caption6}}}|}}&lt;br /&gt;
{{ #if: {{{image7|}}} |File:{{{image7}}}|}}{{ #if: {{{caption7|}}} |{{!}}{{{caption7}}}|}}&lt;br /&gt;
{{ #if: {{{image8|}}} |File:{{{image8}}}|}}{{ #if: {{{caption8|}}} |{{!}}{{{caption8}}}|}}&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
|}}&lt;br /&gt;
'''Source''': {{{source}}} {{#tag:ref|&lt;br /&gt;
{{{source}}} {{{companyURL|}}}&lt;br /&gt;
}}  &amp;lt;noinclude&amp;gt;Return to [[Image:Timber.png|20px]][[:Category:Timber|All Timber entries Category Listing]].&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&amp;lt;br style=&amp;quot;clear:both&amp;quot; /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/MediaWiki:Sidebar</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/MediaWiki:Sidebar"/>
				<updated>2017-08-24T19:30:55Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: /* add Timber products category */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*navigation &lt;br /&gt;
**mainpage|Main&lt;br /&gt;
**Category:Botanical|All botanicals&lt;br /&gt;
**Category:Voucher|Botanical Vouchers&lt;br /&gt;
**Category:Organolepsy|Organoleptic entries&lt;br /&gt;
**Category:Macroscopy|Macroscopy entries&lt;br /&gt;
**Category:Microscopy|Microscopy entries&lt;br /&gt;
**Category:HPLC|HPLC entries&lt;br /&gt;
**Category:HPTLC|HPTLC entries&lt;br /&gt;
**Category:DNA|DNA entries&lt;br /&gt;
**Category:Timber|Timber products&lt;br /&gt;
**Category:AHPA_Known_Adulterants|AHPA Known Adulterants guidances&lt;br /&gt;
**Category:AHPA Practicals|AHPA practicals (white papers)&lt;br /&gt;
**portal-url|portal &lt;br /&gt;
**currentevents-url|currentevents &lt;br /&gt;
**recentchanges-url|recentchanges &lt;br /&gt;
**randompage-url|randompage &lt;br /&gt;
**helppage|help   &lt;br /&gt;
*SEARCH &lt;br /&gt;
*SUPPORTED BY&lt;br /&gt;
**sponsors-url|sponsors &lt;br /&gt;
**Botanical Reference Materials|Botanical reference materials&lt;br /&gt;
*TOOLBOX &lt;br /&gt;
*LANGUAGES&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Passiflora_incarnata_(aerial_parts)</id>
		<title>Passiflora incarnata (aerial parts)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Passiflora_incarnata_(aerial_parts)"/>
				<updated>2016-09-27T11:58:27Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: corrected voucher entry&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Passiflora incarnata'' (aerial parts)}} {{askbox|herb=''Passiflora incarnata''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
&lt;br /&gt;
{{nomenclature | binomial=Passiflora incarnata&lt;br /&gt;
|authority=L.&lt;br /&gt;
|family=Passifloraceae&lt;br /&gt;
|scn=passionflower&lt;br /&gt;
|syn=&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=apricot vine; maypop; wild passionflower&lt;br /&gt;
|notes= }}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media3     |cat=Voucher &lt;br /&gt;
&lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Passiflora_incarnata_Tropicos_67675.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/67675&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/67675&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | source2=MOBOT, Tropicos.org&lt;br /&gt;
             | image2=Passiflora_incarnata_Tropicos_67682.jpg&lt;br /&gt;
             | companyimage2=TropicosLogo.gif&lt;br /&gt;
             | companyURL2=http://www.tropicos.org/Image/67682&lt;br /&gt;
             | reference2=Tropicos.org. Missouri Botanical Garden. 26 Mar 2014 &amp;lt;http://www.tropicos.org/Image/67682&amp;gt;&lt;br /&gt;
&lt;br /&gt;
             | source3=Trish Flaster, MSc, Botanical Liaisons, LLC &lt;br /&gt;
             | image3=Passiflora incarnata - Botanical Liasons.jpg&lt;br /&gt;
             | companyimage3=Botanical liasons logo.png&lt;br /&gt;
             | companyURL3=http://www.BotanicalLiaisons.com&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=[''Passiflora incarnata''] Taste and odor slight.}}&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
|&lt;br /&gt;
{{Macroscopy | source=American Medicinal Plants of Commercial Importance (1930)&lt;br /&gt;
| description=The plant is a smooth vine with finely hairy stems climbing to a height of 10 to 30 feet.  Its smooth or somewhat hairy leaves, 3 to 5 inches broad, consist of three oval or egg-shaped lobes with finely toothed margins.  The flowers, which appear May to July, are solitary and are characterized by a lavender and purple or pink and purple fringe 1 1/2 to 2 inches broad.  The plant produces smooth, yellow, many-seeded, edible fruit almost 2 inches long, called maypops.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
{{Macroscopy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=Stems glabrous or slightly pubescent above, striate, from 6 to 8 mm. in diameter, of variable length, woody, hollow, the cavity about one-half the diameter; bark very thin, greenish or purplish; wood very porous and bordered on the inner side by a thin layer of pith; fracture of the wood uneven, of the stem smooth, of the bark coarsely fibrous. Leaves more or less broken in drying, rather thick, glabrous or often pubescent, when entire nearly orbicular in outline, base cordate, deeply three- to five-lobed, lobes ovate, acute, finely serrate, petioles from 1 to 5 cm. in length, with two glands near the summit. Tendrils numerous and closely coiled, Flowers solitary, axillary, peduncles as long as the petioles, usually three bracted; calyx cup-shaped, four to five lobes; lobes linear, imbricated, cuspidate, corona of the fresh flowers purplish; petals four to five, yellow; ovary oblong, stalked; stamens monadelphus in a tube about the stalk of the ovary, separated above, anthers narrow, versatile. Fruit from 4 to 5 cm. in length, an ovoid, many-seeded berry; externally green or yellow, shriveled and wrinkled; seeds flat, ovate, yellowish to brown arilled. }}&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 235.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 1834.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{{Media4 |cat=Microscopy |companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL= http://www.alkemist.com&lt;br /&gt;
|companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2= http://www.alkemist.com&lt;br /&gt;
|companyimage3= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL3= http://www.alkemist.com&lt;br /&gt;
|companyimage4= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL4= http://www.alkemist.com&lt;br /&gt;
|mainimage= Passiflora_incarnata-1_-_Alkemist_Laboratories.jpg&lt;br /&gt;
           |caption1= Pollen grain measuring greater than 70 μm in diameter and showing a reticulated exine observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source= Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
|image2= Passiflora_incarnata-2_-_Alkemist_Laboratories.jpg&lt;br /&gt;
           |caption2= Clusters of calcium oxalate observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source2= Elan M. Sudberg, Alkemist Laboratories &lt;br /&gt;
|image3= Passiflora_incarnata-3_-_Alkemist_Laboratories.jpg&lt;br /&gt;
           |caption3= Large fragment of a fiber from the stem observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source3= Elan M. Sudberg, Alkemist Laboratories &lt;br /&gt;
|image4= Passiflora_incarnata-4_-_Alkemist_Laboratories.jpg&lt;br /&gt;
           |caption4= Beaded cell walls of the corolla observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
           |source4= Elan M. Sudberg, Alkemist Laboratories }}&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=HPTLC Association&lt;br /&gt;
             | companyimage=HPTLC-assoc-Logo-farbig-Text-schwarz-300x47.png&lt;br /&gt;
             | companyURL=http://www.hptlc-association.org/&lt;br /&gt;
             | mainimage=Passiflora incarnata-uv366nm-hptlc-association.png&lt;br /&gt;
             | caption1=Passiflora incarnata (aerial parts) HPTLC ID - Sulfuric acid reagent, white RT&lt;br /&gt;
             | description=Passion flower (aerial parts) (''Passiflora incarnata'')&lt;br /&gt;
             |&lt;br /&gt;
             | stationaryphase=Stationary phase, i.e. Silica gel 60, F254&lt;br /&gt;
             | mobilephase=Ethyl acetate, formic acid, water, ethyl methyl ketone 50:10:10:30 (v/v/v/v)&lt;br /&gt;
             | prep=Sample: Mix 500 mg of powdered sample with 5 mL of methanol and sonicate for 10 minutes, then centrifuge or filter the solutions and use the supernatants / filtrates as test solutions.&lt;br /&gt;
&lt;br /&gt;
Derivatization reagents: 1) NP reagent Preparation: Dissolve 1g of natural products reagent in 200 mL of ethyl acetate. 2) PEG reagent Preparation: Dissolve 10 g of polyethylene glycol 400 in 200 mL of methylene chloride.  Use: Heat plate for 3 min at 100°C, dip (time 0, speed 5) in NP reagent, dry and dip (time 0, speed 5) in PEG reagent.&lt;br /&gt;
             | detection=Saturated chamber; developing distance 70 mm from lower edge; relative humidity 33%&lt;br /&gt;
             | referencesamples=Reference: Individually dissolve 2 mg each of rutin and hyperoside in 5 mL of methanol. &lt;br /&gt;
             |&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Rutin&lt;br /&gt;
# 2 μL Hyperoside&lt;br /&gt;
# 4 μL Passion flower 1&lt;br /&gt;
# 4 μL Passion flower 2&lt;br /&gt;
# 4 μL ''Passiflora caerulea''&lt;br /&gt;
# 4 μL ''Passiflora edulis''&lt;br /&gt;
# 4 μL ''Passiflora biflora''&lt;br /&gt;
&lt;br /&gt;
             | notes=Images presented in this entry are examples and are not intended to be used as a bases for setting specifications for quality control purposes.&lt;br /&gt;
&lt;br /&gt;
System suitability test:&lt;br /&gt;
Rutin: orange zone at Rf ~ 0.32.&lt;br /&gt;
Asiaticoside: orange zone at Rf ~ 0.50.&lt;br /&gt;
&lt;br /&gt;
Identification:&lt;br /&gt;
Compare result with reference images.  The fingerprint of the test solution is similar to that of the corresponding botanical reference sample.  Additional weak zones may be present.&lt;br /&gt;
The chromatogram of the test solution shows a greenish to yellow zone at Rf ~ 0.16.  In the center of the chromatogram, above the position of reference substrate rutin there are four characteristic fluorescent zones: a yellow zone at Rf ~ 0.43, a green zone at Rf ~ 0.48, another yellow zone at Rf ~ 0.53 right above the position of the reference substance hyperoside, and another green zone at Rf ~ 0.60.  Right below the solvent front there are red zones due to chlorophylls.&lt;br /&gt;
&lt;br /&gt;
Test for other species:&lt;br /&gt;
No zone is seen between the green zone at Rf ~ 0.16 and the lowest zone of the group of four zones (yellow zone at Rf ~ 0.43) (''Passiflora caerulea'', ''Passiflora edulis'', ''Passiflora biflora'').  No yellow zones are detected between the upper green zone at Rf ~ 0.60 and the red zones below the solvent front (''Passiflora biflora'').&lt;br /&gt;
             | }}&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
&lt;br /&gt;
=Sources=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;br /&gt;
[[Category:Botanical]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)</id>
		<title>Euphrasia stricta (aerial parts)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)"/>
				<updated>2016-07-19T18:57:22Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: microscopy revision per contributor request&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Euphrasia stricta'' (aerial parts) }} {{askbox|herb=''Euphrasia stricta''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Euphrasia stricta&lt;br /&gt;
|authority=J.P. Wolff ex J.F. Lehm.&lt;br /&gt;
|family=Scrophulariaceae&lt;br /&gt;
|scn=eyebright&lt;br /&gt;
|syn=''Euphrasia officinalis''&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes=}}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2      |cat=Voucher &lt;br /&gt;
             &lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Euphrasia officinalis Tropicos 100285389.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100285389&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 19 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100285389&amp;gt;&lt;br /&gt;
             &lt;br /&gt;
&lt;br /&gt;
| companyimage2=Kewlogo.gif&lt;br /&gt;
| companyURL2=http://specimens.kew.org/herbarium/K000195686&lt;br /&gt;
| image2=Euphrasia_officinalis_Kew_imageBarcode=K000195686_98404.jpg&lt;br /&gt;
| source2=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''E. officinalis'' is a small annual plant without odor, and of a bitterish, astringent taste.}}&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 3012.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 2644.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Eyebright (aerial parts) (''Euphrasia officinalis'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Euphrasia_officinalis_-_Alkemists_Laboratories.jpg&lt;br /&gt;
             | caption1=''Euphrasia officinalis'' HPTLC ID - Vanillin/Sulfuric Acid Reagent UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=chloroform: methanol: water [6/4/0.4]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicated + heated @ 50° C ~ 1 hr&lt;br /&gt;
             | detection=Vanillin/H2SO4 Reagent -&amp;gt; 110° C 5 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Aucubin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-1 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-2 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-4 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-5 (aerial parts)&lt;br /&gt;
# 2 μL Catalpol ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)</id>
		<title>Euphrasia stricta (aerial parts)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)"/>
				<updated>2016-04-28T15:44:46Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: microscopy caption revisions re: MS 4/28&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Euphrasia stricta'' (aerial parts) }} {{askbox|herb=''Euphrasia stricta''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Euphrasia stricta&lt;br /&gt;
|authority=J.P. Wolff ex J.F. Lehm.&lt;br /&gt;
|family=Scrophulariaceae&lt;br /&gt;
|scn=eyebright&lt;br /&gt;
|syn=''Euphrasia officinalis''&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes=}}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2      |cat=Voucher &lt;br /&gt;
             &lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Euphrasia officinalis Tropicos 100285389.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100285389&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 19 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100285389&amp;gt;&lt;br /&gt;
             &lt;br /&gt;
&lt;br /&gt;
| companyimage2=Kewlogo.gif&lt;br /&gt;
| companyURL2=http://specimens.kew.org/herbarium/K000195686&lt;br /&gt;
| image2=Euphrasia_officinalis_Kew_imageBarcode=K000195686_98404.jpg&lt;br /&gt;
| source2=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''E. officinalis'' is a small annual plant without odor, and of a bitterish, astringent taste.}}&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 3012.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 2644.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Microscopy | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Eyebright-1.jpg&lt;br /&gt;
             | caption1=Red pigmented fragment of the anther observed at 400x in Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
| source2=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
             | image2=Eyebright-2.jpg&lt;br /&gt;
             | caption2=Thick-walled trichome showing rough cuticle observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | characteristics=cellular structures identified in this botanical specimen are the red pigmented fragment of the anther as a result of the reaction with chloral hydrate and the thick-walled trichome showing rough cuticle when observed at 400x in Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Eyebright (aerial parts) (''Euphrasia officinalis'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Euphrasia_officinalis_-_Alkemists_Laboratories.jpg&lt;br /&gt;
             | caption1=''Euphrasia officinalis'' HPTLC ID - Vanillin/Sulfuric Acid Reagent UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=chloroform: methanol: water [6/4/0.4]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicated + heated @ 50° C ~ 1 hr&lt;br /&gt;
             | detection=Vanillin/H2SO4 Reagent -&amp;gt; 110° C 5 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Aucubin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-1 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-2 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-4 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-5 (aerial parts)&lt;br /&gt;
# 2 μL Catalpol ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)</id>
		<title>Euphrasia stricta (aerial parts)</title>
		<link rel="alternate" type="text/html" href="https://www.botanicalauthentication.org/index.php/Euphrasia_stricta_(aerial_parts)"/>
				<updated>2016-04-28T15:43:04Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: correct typesetting&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{DISPLAYTITLE:''Euphrasia stricta'' (aerial parts) }} {{askbox|herb=''Euphrasia stricta''}}&lt;br /&gt;
=Nomenclature=&lt;br /&gt;
{{nomenclature | binomial=Euphrasia stricta&lt;br /&gt;
|authority=J.P. Wolff ex J.F. Lehm.&lt;br /&gt;
|family=Scrophulariaceae&lt;br /&gt;
|scn=eyebright&lt;br /&gt;
|syn=''Euphrasia officinalis''&lt;br /&gt;
|ayurvedic=&lt;br /&gt;
|pinyin=&lt;br /&gt;
|aka=&lt;br /&gt;
|notes=}}&lt;br /&gt;
&lt;br /&gt;
=Botanical Voucher Specimen=&lt;br /&gt;
&lt;br /&gt;
{{Media2      |cat=Voucher &lt;br /&gt;
             &lt;br /&gt;
             | source=MOBOT, Tropicos.org&lt;br /&gt;
             | mainimage=Euphrasia officinalis Tropicos 100285389.jpg&lt;br /&gt;
             | companyimage=TropicosLogo.gif&lt;br /&gt;
             | companyURL=http://www.tropicos.org/Image/100285389&lt;br /&gt;
             | reference=Tropicos.org. Missouri Botanical Garden. 19 Mar 2014 &amp;lt;http://www.tropicos.org/Image/100285389&amp;gt;&lt;br /&gt;
             &lt;br /&gt;
&lt;br /&gt;
| companyimage2=Kewlogo.gif&lt;br /&gt;
| companyURL2=http://specimens.kew.org/herbarium/K000195686&lt;br /&gt;
| image2=Euphrasia_officinalis_Kew_imageBarcode=K000195686_98404.jpg&lt;br /&gt;
| source2=Royal Botanic Gardens, Kew. &lt;br /&gt;
&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Organoleptic Characteristics=&lt;br /&gt;
{| border=1&lt;br /&gt;
| &lt;br /&gt;
{{Organolepsy | source=United States Dispensatory (1918)&lt;br /&gt;
| description=''E. officinalis'' is a small annual plant without odor, and of a bitterish, astringent taste.}}&lt;br /&gt;
|}&lt;br /&gt;
=Macroscopic Characteristics=&lt;br /&gt;
&lt;br /&gt;
{{ Media2    | cat=Macroscopy &lt;br /&gt;
             | source=PlantaPhile &lt;br /&gt;
             | mainimage=PlantaPhile - 3012.jpg&lt;br /&gt;
             | companyimage=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL=http://plantaphile.com/&lt;br /&gt;
&lt;br /&gt;
             | source2=PlantaPhile &lt;br /&gt;
             | image2=PlantaPhile - 2644.jpg&lt;br /&gt;
             | companyimage2=PlantaPhile logo.jpg&lt;br /&gt;
             | companyURL2=http://plantaphile.com/&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=Microscopic Characteristics=&lt;br /&gt;
{{Media2 |cat=Microscopy | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Eyebright-1.jpg&lt;br /&gt;
             | caption1=Red pigmented fragment of the anther as a result of the reaction with chloral hydrate observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
| source2=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | companyimage2= AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL2=http://www.alkemist.com&lt;br /&gt;
             | image2=Eyebright-2.jpg&lt;br /&gt;
             | caption2=Thick-walled trichome showing rough cuticle observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | characteristics=cellular structures identified in this botanical specimen are the red pigmented fragment of the anther as a result of the reaction with chloral hydrate and the thick-walled trichome showing rough cuticle when observed at 400x with Acidified Chloral Hydrate Glycerol Solution.&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
=High Performance Thin Layer Chromatographic Identification=&lt;br /&gt;
{{HPTLC | source=Elan M. Sudberg, Alkemist Laboratories&lt;br /&gt;
             | description=Eyebright (aerial parts) (''Euphrasia officinalis'')&lt;br /&gt;
             | companyimage=AP-LOGO-Laboratories Crop - Copy.jpg&lt;br /&gt;
             | companyURL=http://www.alkemist.com&lt;br /&gt;
             | mainimage=Euphrasia_officinalis_-_Alkemists_Laboratories.jpg&lt;br /&gt;
             | caption1=''Euphrasia officinalis'' HPTLC ID - Vanillin/Sulfuric Acid Reagent UV 365 nm&lt;br /&gt;
             | stationaryphase=Silica gel 60, F254, 10 x 10 cm HPTLC plates&lt;br /&gt;
             | mobilephase=chloroform: methanol: water [6/4/0.4]&lt;br /&gt;
             | prep=0.3 g + 3 ml CH3OH sonicated + heated @ 50° C ~ 1 hr&lt;br /&gt;
             | detection=Vanillin/H2SO4 Reagent -&amp;gt; 110° C 5 min -&amp;gt; UV 365 nm&lt;br /&gt;
             | lanes= Lanes, from left to right (Track, Volume, Sample):&lt;br /&gt;
# 2 μL Aucubin ~0.1% in CH3OH&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-1 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-2 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-3 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-4 (aerial parts)&lt;br /&gt;
# 3 μL ''Euphrasia officinalis''-5 (aerial parts)&lt;br /&gt;
# 2 μL Catalpol ~0.1% in CH3OH&lt;br /&gt;
&lt;br /&gt;
Reference materials used here have been authenticated by macroscopic, microscopic &amp;amp;/or TLC studies according to the reference source cited below held at Alkemists Laboratories, Costa Mesa, CA.&lt;br /&gt;
&lt;br /&gt;
             | reference=Herbal Drugs and Phytopharmaceuticals, Max Wichtl, 3rd ed., 2004&lt;br /&gt;
             | }}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=Supplementary Information=&lt;br /&gt;
=Sources=&lt;br /&gt;
&amp;lt;references /&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	</feed>