Actaea racemosa (root and rhizome)

From AHPA Botanical Identity References Compendium
(Difference between revisions)
Jump to: navigation, search
(→‎updates to ABC-AHP-NCNPR Botanical Adulterants Prevention Program program title)
 
(17 intermediate revisions by 2 users not shown)
Line 11: Line 11:
 
=Botanical Voucher Specimen=
 
=Botanical Voucher Specimen=
  
−
{{media |companyimage=TropicosLogo.gif
+
{{media3 |companyimage=TropicosLogo.gif
 
  | companyURL=http://www.tropicos.org/Image/100105518
 
  | companyURL=http://www.tropicos.org/Image/100105518
 
  |mainimage=Actaea racemosa Tropicos 100105518.jpg
 
  |mainimage=Actaea racemosa Tropicos 100105518.jpg
 
  |source=Tropicos.org. Missouri Botanical Garden. 05 Aug 2013
 
  |source=Tropicos.org. Missouri Botanical Garden. 05 Aug 2013
−
  |cat=Voucher}}
+
  |cat=Voucher
 +
 
 +
 
 +
| companyimage2=Kewlogo.gif
 +
| companyURL2=http://specimens.kew.org/herbarium/K000694465
 +
| image2=Actaea_racemosa_Kew_imageBarcode=K000694465_306208.jpg
 +
| source2=Royal Botanic Gardens, Kew.
 +
 
 +
| companyimage3=Kewlogo.gif
 +
| companyURL3=http://specimens.kew.org/herbarium/K000694466
 +
| image3=Actaea_racemosa_Kew_imageBarcode=K000694466_306208.jpg
 +
| source3=Royal Botanic Gardens, Kew.
 +
 
 +
}}
  
 
=Organoleptic Characteristics=
 
=Organoleptic Characteristics=
Line 21: Line 34:
 
|
 
|
  
−
{{Macroscopy | source=United States Dispensatory (1918)
+
{{Organolepsy | source=United States Dispensatory (1918)
 
| description=Rhizome externally dark brown; internally whitish and mealy or dark brown and waxy; odor slight; taste bitter and acrid.  
 
| description=Rhizome externally dark brown; internally whitish and mealy or dark brown and waxy; odor slight; taste bitter and acrid.  
  
Line 37: Line 50:
 
"Rhizome horizontal, more or less branching, from 2 to 12 cm. in length, and from 1 to 2.5 cm. in thickness; externally dark brown, slightly annulate from circular scars of bud scale-leaves, the upper surface with numerous stout, erect or somewhat curved branches terminated by deep, cup-shaped sears, each of which usually shows a distinct radiate structure; inferior and lateral portions with numerous root-scars and a few short roots; fracture horny; internally whitish and mealy or dark brown and waxy, bark thin, wood distinctly radiate and of about the same thickness as the pith... Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown, longitudinally wrinkled; fracture short; internally bark dark brown, wood yellowish, 4 to 6-rayed."
 
"Rhizome horizontal, more or less branching, from 2 to 12 cm. in length, and from 1 to 2.5 cm. in thickness; externally dark brown, slightly annulate from circular scars of bud scale-leaves, the upper surface with numerous stout, erect or somewhat curved branches terminated by deep, cup-shaped sears, each of which usually shows a distinct radiate structure; inferior and lateral portions with numerous root-scars and a few short roots; fracture horny; internally whitish and mealy or dark brown and waxy, bark thin, wood distinctly radiate and of about the same thickness as the pith... Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown, longitudinally wrinkled; fracture short; internally bark dark brown, wood yellowish, 4 to 6-rayed."
 
}}
 
}}
−
{{media |cat=Macroscopic
+
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg
−
|companyimage=AP-LOGO-Laboratories Crop - Copy.jpg
+
| companyURL=http://www.ahpa.org/Default.aspx?tabid=84
−
             | companyURL=http://www.alkemist.com
+
|mainimage=2013 BC Cut and Sifted AHPA.JPG
−
|mainimage=Alkemists_Actaea_racemosa_macro.jpg
+
|source=AHPA.org. Raw material sample. (2013)
−
           |caption1=Root, cut and sifted
+
|cat=Macroscopic
−
           |source=Alkemist Laboratories}}
+
 
 +
|companyimage2=AP-LOGO-Laboratories Crop - Copy.jpg
 +
             | companyURL2=http://www.alkemist.com
 +
|image2=Alkemists_Actaea_racemosa_macro.jpg
 +
           |caption2=Root, cut and sifted
 +
           |source2=Alkemist Laboratories
 +
 
 +
|companyimage3=14 0924 AHPA logo High Res.jpg
 +
| companyURL3=http://www.ahpa.org/Default.aspx?tabid=84
 +
|image3=2014 BC SE Kentucky AHPA.JPG
 +
|source3=AHPA.org. Raw material sample. (2014)}}
 +
 
 +
{{media3 |companyimage=14 0924 AHPA logo High Res.jpg
 +
| companyURL=http://www.ahpa.org/Default.aspx?tabid=84
 +
|mainimage=2014 BC SE Missouri AHPA.JPG
 +
|source=AHPA.org. Raw material sample. (2014)
 +
|cat=Macroscopic
 +
 
 +
| companyimage2=14 0924 AHPA logo High Res.jpg
 +
| companyURL2=http://www.ahpa.org/Default.aspx?tabid=84
 +
| image2=2014 BC Virginia AHPA.JPG
 +
| source2=AHPA.org. Raw material sample. (2014)
 +
 
 +
| companyimage3=14 0924 AHPA logo High Res.jpg
 +
| companyURL3=http://www.ahpa.org/Default.aspx?tabid=84
 +
| image3=2014 BC W. Virginia AHPA.JPG
 +
| source3=AHPA.org. Raw material sample. (2014)
 +
 
 +
}}
 +
 
 
|}
 
|}
 +
 +
 
=Microscopic Characteristics=
 
=Microscopic Characteristics=
 
{| border=1
 
{| border=1
Line 63: Line 107:
 
{{HPTLC | source=AHPA Practical, CAMAG HPTLC
 
{{HPTLC | source=AHPA Practical, CAMAG HPTLC
 
             | companyimage=Camag_logo.png
 
             | companyimage=Camag_logo.png
−
             | companyURL=http://www.camag.com/index.php
+
             | companyURL=http://www.camag.com/
 
             | mainimage=Camag-blackcohosh-1-d-uv254.png
 
             | mainimage=Camag-blackcohosh-1-d-uv254.png
 
             | caption1=Black cohosh HPTLC ID - Developed, UV 254 nm
 
             | caption1=Black cohosh HPTLC ID - Developed, UV 254 nm
Line 118: Line 162:
 
             | }}
 
             | }}
  
 +
=DNA Identification=
 +
[[Category:DNA]]
 +
{| border=1
 +
|[[File:NY_Botanical_Garden_logo.png|right|150x75px]]
 +
'''Black Cohosh (''Actaea racemosa'')'''
 +
 +
'''Amplification primers:'''
 +
 +
NY1400 (5′-CAT TTT CTT GAT TTT CTG GGC TA-3′) and NY1401 (5′-CCG GCT TAC TAA TGG GAT G-3′)
 +
 +
'''PCR reaction mixture:'''
 +
 +
15 µL final volume containing 1.5 µL PCR buffer (200 mM tris [pH 8.8], 100 mM KCl, 100 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 20 mM MgSO<sub>4</sub>, 1% [v/v] Triton X-100, 50% [w/v] sucrose, 0.25% [w/v] cresol red), 0.2 µM dNTPs, 0.025 μg/μL bovine serum albumin (BSA), 1 μM of each primer, 0.25 units of ''Taq'' polymerase, and 0.5 µL template DNA.
 +
 +
'''PCR program:''' 95°C for 2.5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, 72°C for 30 s; 72°C for 10 min.
 +
 +
'''Sequencing primers:''' Same as amplification primers.
 +
 +
'''Sequence:'''
 +
5′-TCT TTC AAG TGT ACG AAA AAA TCC TTC GGT GGT AAG GAG TCA AAT GTT AGA AAA TTC ATT TAT TAT AGA CAT TGC TAT TAA TAA GTT TGA TAC TAT AGT CCC AAT TAT TCC TTT GAT TGG ATT ATT GGC TAA AGC GAA ATT TTG TAA CTT ATC GGG G-3′
 +
 +
'''Diagnostic positions:'''
 +
 +
<pre>              0000011111222222233334444444455566667
 +
              1567946789023444705590004567900501130
 +
              2669211792396679602777892010701063662
 +
A. arizonica  GACAGCCCCCGTATTTCCGCACATTACGCTCACTACG
 +
A. asiatica    ........T........TA.G...........T....
 +
A. biternata  ----....T......G..AT............T..TT
 +
A. cimicifuga  TG......T.........A.....C......GT.G..
 +
A. cordifolia  .....................................
 +
A. dahurica    ---.....TT........A....CC..T...GT.G..
 +
A. elata      .......T..........AT..G.....G........
 +
A. pachypoda  ........T........TA.............T....
 +
A. podocarpa  .......T...C......AT......A..........
 +
A. racemosa    ...M....T........TA..........AA.T....
 +
A. rubra      -.......T........TA.R...........T....
 +
A. simplex    TRM.....T.......M.A..M..C.Y.S..GT.G..
 +
A. spicata    ........T........TA.............TG...
 +
A. vaginata    ...-AGA.T.A.TGG...A.GA...C.T....T....
 +
 +
</pre>
 +
|}
  
 
=Supplementary Information=
 
=Supplementary Information=
 +
== ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance ==
 +
{{Botanical  | source=ABC-AHP-NCNPR Botanical Adulterants Prevention Program
 +
          | companyimage=BAPP-logo-2018-2line-LOW2.jpg
 +
          | companyURL=http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html
 +
            | description=Black cohosh (root and rhizome) (''Actaea racemosa'')
 +
            | characteristics=This ABC-AHP-NCNPR Botanical Adulterants Prevention Program [http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html black cohosh Laboratory Guidance Document] presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic black cohosh ingredients and non-authentic materials, with particular discussion of other species of ''Actaea'' and other plants also known in China as ''sheng ma''-type species, phenolic acid profiles, and a detailed literature review of methods (including sample characterization via HPLC, HPTLC, MS, and NMR).
 +
              }}
  
 +
== AHPA Known Adulterants List ==
 
{{Botanical | source=AHPA Known Adulterants
 
{{Botanical | source=AHPA Known Adulterants
 
             | description=Black cohosh (root) (''Actaea racemosa'', syn ''Cimicifuga racemosa'')
 
             | description=Black cohosh (root) (''Actaea racemosa'', syn ''Cimicifuga racemosa'')
Line 147: Line 242:
  
 
The third citation below employed phytochemical “fingerprinting” using high-performance liquid chromatography with a photo-diode array detector (HPLC-PDA) and liquid chromatography with mass spectrometry detection (LC-MS) to authenticate black cohosh and differentiate it from 14 other Actaea species.
 
The third citation below employed phytochemical “fingerprinting” using high-performance liquid chromatography with a photo-diode array detector (HPLC-PDA) and liquid chromatography with mass spectrometry detection (LC-MS) to authenticate black cohosh and differentiate it from 14 other Actaea species.
−
 
+
====HPTLC Methods====
 
Verbitski SM, Gourdin GT, Ikenouye LM, McChesney JD, Hildreth J. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.2.268 Detection of Actaea racemosa adulteration by thin-layer chromatography and combined thin-layer chromatography-bioluminescence.] J AOAC Int. 2008 Mar-Apr;91(2):268-75.
 
Verbitski SM, Gourdin GT, Ikenouye LM, McChesney JD, Hildreth J. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.2.268 Detection of Actaea racemosa adulteration by thin-layer chromatography and combined thin-layer chromatography-bioluminescence.] J AOAC Int. 2008 Mar-Apr;91(2):268-75.
  
 
Ankli A, Reich E, Steiner M. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.6.1257 Rapid high-performance thin-layer chromatographic method for detection of 5% adulteration of black cohosh with ''Cimicifuga foetida'', ''C. heracleifolia'', ''C. dahurica'', or ''C. americana''.] J AOAC Int. 2008 Nov-Dec;91(6):1257-64.
 
Ankli A, Reich E, Steiner M. [http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.91.6.1257 Rapid high-performance thin-layer chromatographic method for detection of 5% adulteration of black cohosh with ''Cimicifuga foetida'', ''C. heracleifolia'', ''C. dahurica'', or ''C. americana''.] J AOAC Int. 2008 Nov-Dec;91(6):1257-64.
−
 
+
====HPLC Method====
 +
[[Category:HPLC]]
 
Jiang B, Ma C, Motley T, Kronenberg F, Kennelly EJ. [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/abstract Phytochemical fingerprinting to thwart black cohosh adulteration: a 15 ''Actaea'' species analysis.] Phytochem Anal. 2011 Feb 19. doi: 10.1002/pca.1285. [Epub ahead of print] Supporting information is available [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/suppinfo here].  
 
Jiang B, Ma C, Motley T, Kronenberg F, Kennelly EJ. [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/abstract Phytochemical fingerprinting to thwart black cohosh adulteration: a 15 ''Actaea'' species analysis.] Phytochem Anal. 2011 Feb 19. doi: 10.1002/pca.1285. [Epub ahead of print] Supporting information is available [http://onlinelibrary.wiley.com/doi/10.1002/pca.1285/suppinfo here].  
  
Line 159: Line 255:
  
 
==Other Publications==
 
==Other Publications==
−
===Qiu, ''et al.'', 2014===
+
===NMR Barcoding, Qiu, ''et al.'', 2014===
 
'''2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes,'''  
 
'''2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes,'''  
 
<blockquote>'''Abstract.'''
 
<blockquote>'''Abstract.'''
  
−
The interpretation of NMR spectroscopic information for structure elucidation involves decoding of complex resonance patterns that contain valuable molecular information (δ and J), which is not readily accessible otherwise. We introduce a new concept of 2D-NMR barcoding that uses clusters of fingerprint signals and their spatial relationships in the δ−δ coordinate space to facilitate the chemical identification of complex mixtures. Similar to widely used general barcoding technology, the structural information of individual compounds is encoded as a specifics pattern of their C,H correlation signals. Software-based recognition of these patterns enables the structural identification of the compounds and their discrimination in mixtures. Using the triterpenes from various Actaea (syn. Cimicifuga) species as a test case, heteronuclear multiple-bond correlation (HMBC) barcodes were generated on the basis of their structural subtypes from a statistical investigation of their δH and δC data in the literature. These reference barcodes allowed in silico identification of known triterpenes in enriched fractions obtained from an extract of A. racemosa (black cohosh). After dereplication, a differential analysis of heteronuclear single-quantum correlation (HSQC) spectra even allowed for the discovery of a new triterpene. The 2D barcoding concept has potential application in a natural product discovery project, allowing for the rapid dereplication of known compounds and as a tool in the search for structural novelty within compound classes with established barcodes.<ref>'''2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes'''
+
The interpretation of NMR spectroscopic information for structure elucidation involves decoding of complex resonance patterns that contain valuable molecular information (δ and J), which is not readily accessible otherwise. We introduce a new concept of 2D-NMR barcoding that uses clusters of fingerprint signals and their spatial relationships in the δ−δ coordinate space to facilitate the chemical identification of complex mixtures. Similar to widely used general barcoding technology, the structural information of individual compounds is encoded as a specifics pattern of their C,H correlation signals. Software-based recognition of these patterns enables the structural identification of the compounds and their discrimination in mixtures. Using the triterpenes from various Actaea (syn. Cimicifuga) species as a test case, heteronuclear multiple-bond correlation (HMBC) barcodes were generated on the basis of their structural subtypes from a statistical investigation of their δH and δC data in the literature. These reference barcodes allowed in silico identification of known triterpenes in enriched fractions obtained from an extract of A. racemosa (black cohosh). After dereplication, a differential analysis of heteronuclear single-quantum correlation (HSQC) spectra even allowed for the discovery of a new triterpene. The 2D barcoding concept has potential application in a natural product discovery project, allowing for the rapid dereplication of known compounds and as a tool in the search for structural novelty within compound classes with established barcodes.<ref>
−
    Feng Qiu, James B. McAlpine, David C. Lankin, Ian Burton, Tobias Karakach, Shao-Nong Chen, and Guido F. Pauli
+
    Qiu, F., McAlpine, J.B., Lankin, D.C., Burton, I., Karakach, T., Chen, S., Pauli G.F. 2014. 2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes ''Analytical Chemistry''  86(8), 3964-3972. http://pubs.acs.org/doi/abs/10.1021/ac500188j</ref></blockquote>
−
    ''Analytical Chemistry'' '''2014''' ''86'' (8), 3964-3972. http://pubs.acs.org/doi/abs/10.1021/ac500188j</ref></blockquote>
+
 
 +
===Countercurrent Chromatography, Cicek, ''et al.'', 2010===
 +
'''Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection.'''
 +
 
 +
<blockquote>'''Abstract.'''
 +
 
 +
In the present work, a fast and simple method for the separation and purification of triterpene saponins from Actaea racemosa was successfully established. Accelerated solvent extraction was used for defatting and extracting of the subaerial parts, giving a triterpene enriched crude extract. Size exclusion chromatography was used to separate actein and 23-epi-26-deoxyactein from other triterpenoids, which were collected in a third fraction. This most complex third fraction was applied to high-speed countercurrent chromatography, a well-established technique for the separation of saponins. Separation parameters were first optimized on an analytical level, using a hyphenated HSCCC-ELSD setup, before the system was scaled up to preparative size. The resulting two-phase solvent system, consisting of N-hexane-acetone-ethyl acetate-2-propanol-ethanol-water (3.5 : 1 : 2 : 1 : 0.5 : 2, v/v/v/v/v/v), enabled the isolation of 23-O-acetylshengmanol-3-O- beta-D-xylopyranoside (17.4 mg), cimiracemoside D (19.5 mg), 25-O-acetylcimigenol-3-O-beta-D-xylopyranoside (7.1 mg) and the aglycone cimigenol (5.9 mg). Purity of the isolated substances was 96.8 %, 96.2 %, 97.9 %, and 98.4 %, respectively. The same method was suitable for the purification of actein and 23-epi-26-deoxyactein, with purities of 97.0 % and 98.3 %.<ref>
 +
Cicek, S.S., Schwaiger, S., Ellmerer, E.P., Stuppner, H. 2010. Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection. ''Planta Med.'' 76(5):467-73.  http://www.ncbi.nlm.nih.gov/pubmed/19847744</ref></blockquote>
 +
 
 +
===HPLC/MS analysis, Liu, ''et al.'', 2003===
 +
[[Category:HPLC]]
 +
'''Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry.'''
 +
 
 +
<blockquote>'''Abstract.'''
 +
 
 +
Caffeic acid derivatives occurring in black cohosh [Cimicifuga racemosa (L.) Nutt., Actaea racemosa (Ranunculaceae)], some of which may have pharmacological activity, were analyzed using high-performance liquid chromatography (HPLC) electrospray ionization tandem mass spectrometry (ESI-MS/MS) with the aim of developing a methodology for their rapid identification in a complex plant matrix. Based on these studies, structurally characteristic product ions and neutral molecule losses were identified, which were then used during LC/MS/MS with product ion scanning, precursor scanning and constant neutral loss scanning to detect caffeic acid derivatives in a crude extract of black cohosh. Several caffeic acid derivatives were detected, and the identification of six of them were confirmed by comparison with authentic standards including caffeic acid, ferulic acid, isoferulic acid, fukinolic acid, cimicifugic acid A, and cimicifugic acid B. Four other compounds were detected that appeared to be caffeic acid derivatives based on LC/MS/MS retention times, molecular weights, and fragmentation patterns during MS/MS. Since standards were unavailable for these four compounds, they were tentatively identified using LC/MS/MS as cimicifugic acid E, cimicifugic acid F, dehydrocimicifugic acid A, and dehydrocimicifugic acid B. Dehydrocimicifugic acid A and dehydrocimicifugic acid B have not been reported previously to be constituents of black cohosh.<ref>
 +
Liu, W., Sun, Y., Liang, W., Fitzloff, J.F., van Breemen, R.B. 2003. Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry. ''Rapid Commun Mass Spectrom.'' 17(9):978-82.  http://www.ncbi.nlm.nih.gov/pubmed/12717772</ref></blockquote>
  
 
=Sources=
 
=Sources=
  
 
<references />
 
<references />

Latest revision as of 17:15, 17 October 2018

AHPA recognizes other valuable resources exist regarding the identity of Actaea racemosa.

To submit a suggestion or contribution, please contact Merle Zimmermann.

Contents

Nomenclature

Actaea racemosa L.   Ranunculaceae  
Syn. Cimicifuga racemosa (L.) Nutt.  
Standardized common name (English): black cohosh

Botanical Voucher Specimen

bottomright bottomright bottomright

Actaea racemosa Tropicos 100105518.jpg
Source: Tropicos.org. Missouri Botanical Garden. 05 Aug 2013[1]

Actaea racemosa Kew imageBarcode=K000694465 306208.jpg
Source: Royal Botanic Gardens, Kew.[2]

Actaea racemosa Kew imageBarcode=K000694466 306208.jpg
Source: Royal Botanic Gardens, Kew.[3]

Organoleptic Characteristics

Rhizome externally dark brown; internally whitish and mealy or dark brown and waxy; odor slight; taste bitter and acrid.

Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown; internally bark dark brown, wood yellowish. The odor, though not strong, is peculiar and rather disagreeable, and is gradually lost with age.
Source: United States Dispensatory (1918) [4]

Macroscopic Characteristics

"... [A] tall stately plant, having a perennial root, and a simple herbaceous stem, which rises from four to eight feet in height. The leaves are large, and ternately decompound, having oblong-ovate leaflets, incised and toothed at their edges. The flowers are small, white, and disposed in a long, terminal, wand-like raceme, with occasionally one or two shorter racemes near its base. The calyx is white, four-leaved, and deciduous; the petals are minute, and shorter than the stamens; the pistil consists of an oval ovary and sessile stigma. The fruit is an ovoid capsule containing numerous flat seeds.

"Rhizome horizontal, more or less branching, from 2 to 12 cm. in length, and from 1 to 2.5 cm. in thickness; externally dark brown, slightly annulate from circular scars of bud scale-leaves, the upper surface with numerous stout, erect or somewhat curved branches terminated by deep, cup-shaped sears, each of which usually shows a distinct radiate structure; inferior and lateral portions with numerous root-scars and a few short roots; fracture horny; internally whitish and mealy or dark brown and waxy, bark thin, wood distinctly radiate and of about the same thickness as the pith... Roots somewhat cylindrical or obtusely quadrangular, from 1 to 3 mm. in thickness, externally dark brown, longitudinally wrinkled; fracture short; internally bark dark brown, wood yellowish, 4 to 6-rayed."

Source: United States Dispensatory (1918) [5]

bottomright bottomright bottomright

2013 BC Cut and Sifted AHPA.JPG
Source: AHPA.org. Raw material sample. (2013)[6]

Alkemists Actaea racemosa macro.jpg
Root, cut and sifted
Source: Alkemist Laboratories[7]

2014 BC SE Kentucky AHPA.JPG
Source: AHPA.org. Raw material sample. (2014)[8]

bottomright bottomright bottomright

2014 BC SE Missouri AHPA.JPG
Source: AHPA.org. Raw material sample. (2014)[9]

2014 BC Virginia AHPA.JPG
Source: AHPA.org. Raw material sample. (2014)[10]

2014 BC W. Virginia AHPA.JPG
Source: AHPA.org. Raw material sample. (2014)[11]


Microscopic Characteristics

"Under the microscope, sections of the rhizome ... show a yellowish-brown suberized epidermis, a cortex made up of about 30 layers of starch-bearing parenchyma cells; the fibro-vascular bundles collateral, the xylem consisting of tracheae with bordered pores, and resembling tracheids in that the ends are rather acute; wood-fibers numerous, thin-walled, strongly lignified and with simple, oblique pores, the bundles separated by starch-bearing parenchyma strands from 5 to 30 cells wide; pith cells numerous, resembling those of the cortex.

"... sections of the root ... show a hairy epidermis, which becomes suberized in older roots; the cortex shows about 12 rows of starch-bearing parenchyma cells; endodermis distinct; fibro-vascular bundles 4 to 6, showing in older roots as separate collateral bundles. The powder is light to dark brown; starch grains numerous, single or compound, the individual grains spherical or more or less polygonal, each with a somewhat central cleft, from 0.003 to 0.015 mm. in diameter; fragments showing trachea with bordered pores and lignified wood-fibers; irregular, yellowish-brown fragments of suberized epidermis made up of more or less tabular cells, sometimes elongated and considerably thickened."

Source: United States Dispensatory (1918) [12]


bottomright

Alkemists Actaea racemosa brown suberized cells.png
Brown suberized cells (400X, Acidified chloral hydrate solution)
Source: Elan M. Sudberg, Alkemist Laboratories[13]

High Performance Thin Layer Chromatographic Identification

Camag logo.png
(thumbnail)
Black cohosh HPTLC ID - Developed, UV 254 nm

Black cohosh (root) (Actaea racemosa)

Lane Assignments Lanes, from left to right (Track, Volume, Sample):

  1. 2 μL Isoferulic acid
  2. 2 μL Norcimifugin
  3. 2 μL Actein
  4. 2 μL 23-epi-26-Deoxyactein
  5. 2 μL Cimifugin
  6. 2 μL C. racemosa
  7. 2 μL C. racemosa
  8. 2 μL C. foetida
  9. 2 μL C. heracleifolia
  10. 2 μL C. dahurica
  11. 2 μL C. americana 

Reference Sample(s) Reference: Dissolve 1mg of actein, 23-epi-26-deoxyactein, isoferulic acid, cimifugin and/or norcimifugin individually in 10 mL of methanol. 

Stationary Phase Stationary phase, i.e. Silica gel 60, F254 

Mobile Phase Toluene, ethyl formate, formic acid 50:30:20 (v/v/v) 

Sample Preparation Method Sample: Mix 0.5 g of powdered sample with 10 mL of an ethanolwater mixture (1:1) and sonicate for 10 minutes, then centrifuge or filter the solutions and use the supernatants/filtrates as test solutions.

Sulfuric Acid Reagent: Preparation: 20 mL of sulfuric acid are mixed with 180 mL of ice-cooled methanol 

Detection Method UV/Vis, Sulfuric Acid Reagent Use: Dip (time 0, speed 5), heat at 100°C for 5 min 

Other Notes Compare result under UV 254 nm and white RT with reference images in Image Comparison Viewer. The fingerprint of the test solution is similar to that of the corresponding botanical reference sample. Additional weak zones may be present.

C. racemosa Identification: Under UV 254 nm the chromatogram obtained with the test solution does not show a dark zone at the position of Cimifugin in the reference solution or just above it. Under white RT a characteristic fingerprint is detected. Below Cimifugin there are two violet zones. Just above the application position two brown zones are detected (blue arrow). There is no brown zone at the position of Cimifugin, but there might be a faint violet zone. There is a brown zone at the position of actein as well as two brown zone just below. Just above the actein zone is a very thin brown zone (green arrow).

Further methodology available here, in Identification of black cohosh by HPTLC.

Source: AHPA Practical, CAMAG HPTLC [14]

DNA Identification

NY Botanical Garden logo.png

Black Cohosh (Actaea racemosa)

Amplification primers:

NY1400 (5′-CAT TTT CTT GAT TTT CTG GGC TA-3′) and NY1401 (5′-CCG GCT TAC TAA TGG GAT G-3′)

PCR reaction mixture:

15 µL final volume containing 1.5 µL PCR buffer (200 mM tris [pH 8.8], 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% [v/v] Triton X-100, 50% [w/v] sucrose, 0.25% [w/v] cresol red), 0.2 µM dNTPs, 0.025 μg/μL bovine serum albumin (BSA), 1 μM of each primer, 0.25 units of Taq polymerase, and 0.5 µL template DNA.

PCR program: 95°C for 2.5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, 72°C for 30 s; 72°C for 10 min.

Sequencing primers: Same as amplification primers.

Sequence: 5′-TCT TTC AAG TGT ACG AAA AAA TCC TTC GGT GGT AAG GAG TCA AAT GTT AGA AAA TTC ATT TAT TAT AGA CAT TGC TAT TAA TAA GTT TGA TAC TAT AGT CCC AAT TAT TCC TTT GAT TGG ATT ATT GGC TAA AGC GAA ATT TTG TAA CTT ATC GGG G-3′

Diagnostic positions:

               0000011111222222233334444444455566667
               1567946789023444705590004567900501130
               2669211792396679602777892010701063662
A. arizonica   GACAGCCCCCGTATTTCCGCACATTACGCTCACTACG
A. asiatica    ........T........TA.G...........T....
A. biternata   ----....T......G..AT............T..TT
A. cimicifuga  TG......T.........A.....C......GT.G..
A. cordifolia  .....................................
A. dahurica    ---.....TT........A....CC..T...GT.G..
A. elata       .......T..........AT..G.....G........
A. pachypoda   ........T........TA.............T....
A. podocarpa   .......T...C......AT......A..........
A. racemosa    ...M....T........TA..........AA.T....
A. rubra       -.......T........TA.R...........T....
A. simplex     TRM.....T.......M.A..M..C.Y.S..GT.G..
A. spicata     ........T........TA.............TG...
A. vaginata    ...-AGA.T.A.TGG...A.GA...C.T....T....

Supplementary Information

ABC-AHP-NCNPR Botanical Adulterants Prevention Program Laboratory Guidance

BAPP-logo-2018-2line-LOW2.jpg

Black cohosh (root and rhizome) (Actaea racemosa) 

General Characteristics This ABC-AHP-NCNPR Botanical Adulterants Prevention Program black cohosh Laboratory Guidance Document presents an overview and comparison of various analytical technologies and methods used to differentiate between authentic black cohosh ingredients and non-authentic materials, with particular discussion of other species of Actaea and other plants also known in China as sheng ma-type species, phenolic acid profiles, and a detailed literature review of methods (including sample characterization via HPLC, HPTLC, MS, and NMR).

Source: ABC-AHP-NCNPR Botanical Adulterants Prevention Program [15]

AHPA Known Adulterants List

AHPA Logo.gif

Black cohosh (root) (Actaea racemosa, syn Cimicifuga racemosa) 

General Characteristics AHPA recommends in its Known Adulterants list that appropriate steps be taken to assure that this raw material is free of the noted adulterant. Contact AHPA for additional information regarding relevant analytical methods or follow this link for more information. 

Reported Adulterants Chinese cimicifuga (root) (Actaea spp.). Also known as sheng ma or Rhizoma Cimicifugae; consists of Actaea cimicifuga, syn. Cimicifuga foetida; Actaea dahurica, syn. C. dahurica; A. heracleifolia, syn. C. heracleifolia; and possibly other Asian species of Actaea.

Source: AHPA Known Adulterants [16]


AHPA Practical: Detecting Adulteration of Black cohosh root/rhizome

AHPA Logo.gif

Reproduced from [1].

Introduction

The American Herbal Products Association is providing here analytical tools and methods to identify adulteration of raw materials and dietary ingredients labeled as black cohosh (Actaea racemosa syn. Cimicifuga racemosa) root/rhizome, or extracts thereof. This information is provided for industry in order to deal appropriately with reports of adulteration of this ingredient and make wise purchasing decisions.

Background

The economic adulteration of black cohosh root and rhizome with other species is well established. AHPA’s guidance policy on Known Adulterants identifies Chinese cimicifuga root/rhizome, also known as sheng ma or Rhizoma Cimicifugae as known black cohosh adulterants. This material commonly consists of Actaea cimicifuga, syn. Cimicifuga foetida; Actaea dahurica, syn. C. dahurica; A. heracleifolia, syn. C. heracleifolia; and possibly other Asian species of Actaea. The citation below provides a review of Rhizoma Cimicifugae for those wanting additional information.

Li JX, Yu ZY. Cimicifugae rhizoma: from origins, bioactive constituents to clinical outcomes. Curr Med Chem. 2006;13(24):2927-51.

The black cohosh monograph in the Natural Health Ingredients Database of the Canadian Natural Health Products Directorate at Health Canada, available online here or as a pdf file here, references instances where adverse events associated with ingestion of products labeled as containing black cohosh (Actaea racemosa syn. Cimicifuga racemosa) were found to contain plant species that were not black cohosh upon laboratory analysis. The Canadian Adverse Reaction Newsletter (2010 Jan;20(1):1-2) provided specifics on this situation as covered in a January 14, 2010 AHPA Update.

Analytical tools

There are several analytical tools available for the authentication of genuine black cohosh and its differentiation from other species. Two papers detailing the use of high performance thin-layer chromatography (HPTLC) are cited below. The first focuses on detection of black cohosh adulteration by other North American Actaea species while the second deals more specifically with differentiation of black cohosh from Chinese cimicifuga. The full methodology for the HPTLC analysis of the second citation can be accessed via this: Identification of black cohosh by HPTLC.

The third citation below employed phytochemical “fingerprinting” using high-performance liquid chromatography with a photo-diode array detector (HPLC-PDA) and liquid chromatography with mass spectrometry detection (LC-MS) to authenticate black cohosh and differentiate it from 14 other Actaea species.

HPTLC Methods

Verbitski SM, Gourdin GT, Ikenouye LM, McChesney JD, Hildreth J. Detection of Actaea racemosa adulteration by thin-layer chromatography and combined thin-layer chromatography-bioluminescence. J AOAC Int. 2008 Mar-Apr;91(2):268-75.

Ankli A, Reich E, Steiner M. Rapid high-performance thin-layer chromatographic method for detection of 5% adulteration of black cohosh with Cimicifuga foetida, C. heracleifolia, C. dahurica, or C. americana. J AOAC Int. 2008 Nov-Dec;91(6):1257-64.

HPLC Method

Jiang B, Ma C, Motley T, Kronenberg F, Kennelly EJ. Phytochemical fingerprinting to thwart black cohosh adulteration: a 15 Actaea species analysis. Phytochem Anal. 2011 Feb 19. doi: 10.1002/pca.1285. [Epub ahead of print] Supporting information is available here.

The black cohosh monograph in the Natural Health Ingredients Database of the Canadian Natural Health Products Directorate at Health Canada, available online here or as a pdf file here, references instances where adverse events associated with ingestion of products labeled as containing black cohosh (Actaea racemosa syn. Cimicifuga racemosa) were found to contain plant species that were not black cohosh upon laboratory analysis. The Canadian Adverse Reaction Newsletter (2010 Jan;20(1):1-2) provided specifics on this situation as covered in a January 14, 2010 AHPA Update.

The American Herbal Pharmacopoeia and the USP Dietary Supplements Compendium also contain useful information for the differentiation of black cohosh and other species representing common black cohosh adulterants. Authenticated black cohosh reference materials are available from both organizations as well as AHPA member companies Alkemists Laboratories, Botanical Liaisons, and Chromadex. DNA testing can be used to verify authentic species, and rule out the presence of common or other unexpected DNA-containing adulterants or contaminants. Work in this area is currently being conducted by AHPA member AuthenTechnologies.

Other Publications

NMR Barcoding, Qiu, et al., 2014

2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes,

Abstract. The interpretation of NMR spectroscopic information for structure elucidation involves decoding of complex resonance patterns that contain valuable molecular information (δ and J), which is not readily accessible otherwise. We introduce a new concept of 2D-NMR barcoding that uses clusters of fingerprint signals and their spatial relationships in the δ−δ coordinate space to facilitate the chemical identification of complex mixtures. Similar to widely used general barcoding technology, the structural information of individual compounds is encoded as a specifics pattern of their C,H correlation signals. Software-based recognition of these patterns enables the structural identification of the compounds and their discrimination in mixtures. Using the triterpenes from various Actaea (syn. Cimicifuga) species as a test case, heteronuclear multiple-bond correlation (HMBC) barcodes were generated on the basis of their structural subtypes from a statistical investigation of their δH and δC data in the literature. These reference barcodes allowed in silico identification of known triterpenes in enriched fractions obtained from an extract of A. racemosa (black cohosh). After dereplication, a differential analysis of heteronuclear single-quantum correlation (HSQC) spectra even allowed for the discovery of a new triterpene. The 2D barcoding concept has potential application in a natural product discovery project, allowing for the rapid dereplication of known compounds and as a tool in the search for structural novelty within compound classes with established barcodes.[17]

Countercurrent Chromatography, Cicek, et al., 2010

Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection.

Abstract. In the present work, a fast and simple method for the separation and purification of triterpene saponins from Actaea racemosa was successfully established. Accelerated solvent extraction was used for defatting and extracting of the subaerial parts, giving a triterpene enriched crude extract. Size exclusion chromatography was used to separate actein and 23-epi-26-deoxyactein from other triterpenoids, which were collected in a third fraction. This most complex third fraction was applied to high-speed countercurrent chromatography, a well-established technique for the separation of saponins. Separation parameters were first optimized on an analytical level, using a hyphenated HSCCC-ELSD setup, before the system was scaled up to preparative size. The resulting two-phase solvent system, consisting of N-hexane-acetone-ethyl acetate-2-propanol-ethanol-water (3.5 : 1 : 2 : 1 : 0.5 : 2, v/v/v/v/v/v), enabled the isolation of 23-O-acetylshengmanol-3-O- beta-D-xylopyranoside (17.4 mg), cimiracemoside D (19.5 mg), 25-O-acetylcimigenol-3-O-beta-D-xylopyranoside (7.1 mg) and the aglycone cimigenol (5.9 mg). Purity of the isolated substances was 96.8 %, 96.2 %, 97.9 %, and 98.4 %, respectively. The same method was suitable for the purification of actein and 23-epi-26-deoxyactein, with purities of 97.0 % and 98.3 %.[18]

HPLC/MS analysis, Liu, et al., 2003

Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry.

Abstract. Caffeic acid derivatives occurring in black cohosh [Cimicifuga racemosa (L.) Nutt., Actaea racemosa (Ranunculaceae)], some of which may have pharmacological activity, were analyzed using high-performance liquid chromatography (HPLC) electrospray ionization tandem mass spectrometry (ESI-MS/MS) with the aim of developing a methodology for their rapid identification in a complex plant matrix. Based on these studies, structurally characteristic product ions and neutral molecule losses were identified, which were then used during LC/MS/MS with product ion scanning, precursor scanning and constant neutral loss scanning to detect caffeic acid derivatives in a crude extract of black cohosh. Several caffeic acid derivatives were detected, and the identification of six of them were confirmed by comparison with authentic standards including caffeic acid, ferulic acid, isoferulic acid, fukinolic acid, cimicifugic acid A, and cimicifugic acid B. Four other compounds were detected that appeared to be caffeic acid derivatives based on LC/MS/MS retention times, molecular weights, and fragmentation patterns during MS/MS. Since standards were unavailable for these four compounds, they were tentatively identified using LC/MS/MS as cimicifugic acid E, cimicifugic acid F, dehydrocimicifugic acid A, and dehydrocimicifugic acid B. Dehydrocimicifugic acid A and dehydrocimicifugic acid B have not been reported previously to be constituents of black cohosh.[19]

Sources

  1. ↑ Tropicos.org. Missouri Botanical Garden. 05 Aug 2013 http://www.tropicos.org/Image/100105518
  2. ↑ Royal Botanic Gardens, Kew. http://specimens.kew.org/herbarium/K000694465
  3. ↑ Royal Botanic Gardens, Kew. http://specimens.kew.org/herbarium/K000694466
  4. ↑ United States Dispensatory (1918)
  5. ↑ United States Dispensatory (1918)
  6. ↑ AHPA.org. Raw material sample. (2013) http://www.ahpa.org/Default.aspx?tabid=84
  7. ↑ Alkemist Laboratories http://www.alkemist.com
  8. ↑ AHPA.org. Raw material sample. (2014) http://www.ahpa.org/Default.aspx?tabid=84
  9. ↑ AHPA.org. Raw material sample. (2014) http://www.ahpa.org/Default.aspx?tabid=84
  10. ↑ AHPA.org. Raw material sample. (2014) http://www.ahpa.org/Default.aspx?tabid=84
  11. ↑ AHPA.org. Raw material sample. (2014) http://www.ahpa.org/Default.aspx?tabid=84
  12. ↑ United States Dispensatory (1918)
  13. ↑ Elan M. Sudberg, Alkemist Laboratories http://www.alkemist.com
  14. ↑ AHPA Practical, CAMAG HPTLC http://www.camag.com/
  15. ↑ ABC-AHP-NCNPR Botanical Adulterants Prevention Program http://cms.herbalgram.org/BAP/LGD/BlackCohoshLabGuidanceDocument.html
  16. ↑ AHPA Known Adulterants http://www.ahpa.org/
  17. ↑ Qiu, F., McAlpine, J.B., Lankin, D.C., Burton, I., Karakach, T., Chen, S., Pauli G.F. 2014. 2D NMR Barcoding and Differential Analysis of Complex Mixtures for Chemical Identification: The Actaea Triterpenes Analytical Chemistry 86(8), 3964-3972. http://pubs.acs.org/doi/abs/10.1021/ac500188j
  18. ↑ Cicek, S.S., Schwaiger, S., Ellmerer, E.P., Stuppner, H. 2010. Development of a fast and convenient method for the isolation of triterpene saponins from Actaea racemosa by high-speed countercurrent chromatography coupled with evaporative light scattering detection. Planta Med. 76(5):467-73. http://www.ncbi.nlm.nih.gov/pubmed/19847744
  19. ↑ Liu, W., Sun, Y., Liang, W., Fitzloff, J.F., van Breemen, R.B. 2003. Identification of caffeic acid derivatives in Actea racemosa (Cimicifuga racemosa, black cohosh) by liquid chromatography/tandem mass spectrometry. Rapid Commun Mass Spectrom. 17(9):978-82. http://www.ncbi.nlm.nih.gov/pubmed/12717772
MediaWiki Appliance - Powered by TurnKey Linux